Filter Results

General Questions

  1. Go to the create account page. 
  2. Fill in your contact information
  3. *To link your account to pricing discounts, enter the Price Agreement Number for your institution in the "Price agreement#" field. 
  4. Click the create account button.
  5. *You will receive a verification email a few minutes later. You must click the verification link in the email to activate the account. Otherwise the account will not be accessible. 

If you have any trouble creating an account, email customer support. 

Click here to download our vendor information.  If you have any questions or require additional information, please contact Accounts Receivable..

The most common reason for access issues is that the account was never verified. After creating the account, you will receive a verification email. You must click the verification link in the email to activate the account. Check the junk mail folder if you have trouble finding the verification email.

If the issue persists, contact customer support. 

Yes, Eurofins Genomics self-attests to complying with the framework for nucleic acid synthesis screening, including the purchase of gene synthesis equipment, gene synthesis products, nucleic acid synthesis products, and nucleic acid synthesis equipment. Read more.

Orders, Invoices, and General Information

  1. First, go to the order page. The quickest way to navigate to an order page is to click the "Quick Order" button in the top right corner of the screen. This page is also referred to as the order menu page.  
  2. Select the category on the left side > select the product on the right side. These links will direct you to the order page.   
  3. Follow steps in the order control. All order pages follow the same process flow. The options might differ, but the process is consistent. To return to a previous step, click the tab along the top. Do not hit the back button.
    1. Enter or upload sequences/samples.
    2. Select options.
    3. Add the order to the cart.
  4. From the Cart, Click the Checkout button. Alternatively, you can move/copy items to a wishlist to save them, or submit a quote request. 

  5. Follow the steps in checkout. On the final step, click the Checkout button to submit the order. 
    1. Addresses > check if your shipping and billing address are correct.
    2. Preferences > select from a variety of user preferences.
    3. Summary > enter payment information, promo codes, and more.

Click here to view a listing of all the various order messages you will see on the website with detailed explanations.

Go to your Order History. Next, click an order to expand and reveal the download link. To visit the Order History page, click one of the many links located throughout the website, including in the header beside your account information, the main menu, and the order now menu.

Click an order to expand and reveal the download link. Each type of order is color coded by its product line, so it is easy to find the order you want. For example, sequencing orders are marked by a small blue icon, oligo orders are marked by an orange icon, and so forth. Please note that sequencing results are only saved for a limited amount of time. If you are trying to download very old results, it may not be available online but may be archived and available by manual retrieval. Contact us for more information.

The most common cause of this is the date range being too short. By default, the Order History page loads one month of orders. To resolve it, simple expand the date range to view more orders. If you continue to experience problems, please click the chat button in the header and our support team will assist you.

You can checkout of some of our good as a guest, however, to order DNA sequencing services you must be logged into the account. We recommend that you log in for every purchase, since you will not need to enter your shipping adress each time.

Each order editor has a link to the relevant upload template. You can download the same there. Please note that these templates must be used for a successful upload of your sequencing orders.

Quotes

A full tutorial on how to quote items is available on the Quoting System page, under resources and tools.

You can view quotes at two locations.  One, visit the My Quotes page, found under resources and accounts in the main menu.  The second location is on your My Accounts page. The second tab contains a list of your quotes.

Click here to go to the My Quotes page. This page is accessible from the resources/account section in the main navigation bar.

Reordering

Go to your My Orders page and open the order that you wish to reorder. Click the checkbox beside the item(s) and then click the reorder button on the right side.

No, it is not possible to reorder most sequencing submissions due to the dependency on stored primers which may or may not have expired by the reorder point.

Account and EVOcard Questions

Go to the My Orders page. You can view the details of all your orders and download files. If you are logged in, the order history link will appear on the top right corner of the screen under the account icon. 

The sequence data and related information are now availble to you from the 'My Orders' page. You can search and locate your order on the my orders page. Once the order is identified, you can expand the order to get access to the relevant documents. Please familiarize yourself with the order history. You can sort the orders through the business units, dates, or order numbers.

After you log into the www.eurofinsgenomics.com site, you must click on the 'My Orders' link on the top right corner of any page. Locate the order and monitor the status of the order using this 'My Orders' page.

After you log into the www.eurofinsgenomics.com site, you must click on the 'My Orders' link on the top right corner of any page. Locate the relevant order and click on the order to see the details of the order and the tracking number associated with the shipment.

You must log in to access these documents. Once logged in, click on the 'My Orders' link appearing on the top right corner on any page, locate the relevant order and find the oligo analysis data there.

You can save your query parameters on the advanced search.

Starting in Q3 of 2017, Eurofins Genomics switched to e-invoicing instead of paper billing.  Meaning, all invoices will be sent out by email instead of a physical envelope. To ensure there is no interruption to your service, please make sure the email address on your billing address goes to the correct purchasing manager. Most invoice or billing related problems are related to the invoice going to the wrong person or department.  If you have questions, please contact Accounts Receivable.

Once you log on to your account, please click on the 'my orders' link locate on the top right corner of each page. On the order page, locate the order for which you need an invoice. Expand the order to find all the details of the order and the relevant documents. Please note that the details of all the orders have now been consolidate under a single Eurofins Genomics account.

You will be able to locate the balance and transaction history related to EVOcards at this EVOcard managment page. We have migrated the EVOcard balances from the Operon Server to the Eurofins Genomics server. The EVOcard can be used for during check out for your orders.

Oligonucleotides

Oligonucleotides are short strands of DNA or RNA molecules that are widely in research, forensics, and genetic testing. The use of the word oligo has widely replaced the use of 'DNA oligonucleotide'. The term oligonucleotide is derived from the Greek word 'oligo', which means few, and nucleotide, which indicates the building blocks of nucleic acids. These oligos, which can have custom sequences, are chemically manufactured and sold to researchers. While typically oligo is used as a prefix to indicate a few, the limits in case of oligonucleotides have not been precisely defined. Eurofins Genomics has chemically synthesize oligomers of lengths ranging from 5 to 200 nucleotides (nt).

Customers who are new to handling large quantities of material may be surprised to notice a yellow or brown tint in their oligos. If this happens, there's no need for concern. Color variation is a typical occurrence in custom synthesis, particularly as concentrations rise. It's important to note that IDT does not anticipate any impact on the function of oligos in experimental applications due to this color change.

The image above illustrates the normal color variation observed in oligo pools at the same concentration (200 nmol oligos in 15 mL solution). Generally, modified oligos at larger scales are more likely to show this color variation, while smaller, unmodified oligos (e.g., 25 nmol) typically remain colorless in solution.

Overall, synthetic oligos vary in appearance depending on a large number of factors. The lyophilized oligo may appear dry or oily with a clear, white, or brownish color. High concentration may also add color, as covered above. In conclusion, a colored product is not a sign of impurities and should not be a cause for concern. All of Eurofins Genomics’s oligo products meet strict quality control standards before being shipped to our customers.

 

Unmodified oligos are stable molecules and can be used for at least 12 months after purchase when stored at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same oligo, aliquot the oligo sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility of contamination with nucleases or bacteria.

Eurofins Genomics oligos are always shipped salt-free. Before opening, spin the tube at 1000 rpm for 5 min to ensure that the oligonucleotides are at the bottom of the tube. It is recommended that the oligonucleotides be resuspended in a sterile buffered solution (e.g., TE at pH 7.0). Please vortex your oligonucleotides thoroughly after resuspension. The oligonucleotides may not readily dissolve in sterile, distilled water. If NaOH is added to the water, the pH will rise to 7.0 and this should help. If the oligonucleotides are resuspended at pH <7.0 (deionized water may have a pH as low as 5.0), the oligonucleotide could begin to degrade and may lose functionality within a couple of weeks.
For optimal long-term storage, it is recommended that the oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry them and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

Eurofins Genomics uses the industry standard beta-cyanoethyl phosphoramidite chemistry (Caruthers, M. H., 1983, Tetrahedron Lett. 24:245–248) to synthesize oligonucleotides in the 3′ to 5′ direction. For a more granular overview, click here. This chemistry has been proven to be robust and to yield high-quanlity oligos. Different high-throuput synthesizers coupled to different synthetic protocols are used for the synthesis of a range of oligonucleotide products.

NGS Grade is selected from the purification dropdown menu on the oligo order pages.  It is available on the custom DNA oligo tube and plate order page, as well as the EXTREmer tube and plate order page.

HPSF stands for High Purity, Salt Free. This is a proprietary cartridge-based purification method that provides a highly pure oligo.
Eight elution steps, including in situ cleavage of the dimethoxytrityl (DMT) protecting group, ensures that nearly all n-x oligomers, protecting groups, and salts are washed away.

Once the oligo is synthesized and washed, we perform the following analytical tests:
a) OD measurement
The final yield of the oligo is calculated based on the optical density (OD) measurement. The absorbance at 260 nm is recorded. One OD unit of DNA is the amount of DNA in 1.0 mL of ddH2O that gives an absorbance reading A260 = 1.0 when measured using a 1 cm quartz cuvette. 1 OD typically corresponds to ~33 μg/mL of ssDNA.
b) MALDI-TOF MS
The identity of each oligo is verified by mass-spectrometry. Analysis by Matrix Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) is the default method of choice for most of the oligo synthesized by us.
c) Capillary Gel Electrophoresis (CGE)
Analysis by CGE is routinely performed on unmodified oligonucleotides (>60 nt long) which have been purified by RP-HPLC.

Over the years, Eurofins Genomics has identified few sequence-dependent features that can make the production of the oligo difficult. One prominent example is the synthesis of oligos containing a high percentage of 'G' residues, in particular, stretches of 'G'. Besides synthetic challenges, these oligo are also difficult to purify, becuase such oligos with 4 or more 'G's in a row tend to aggregate and form a 'guanine tetraplex' (Poon & MacGregor, 1998, Biopolymers 45:427–434). Similarly, oligos with self-complementary sequences tend to form aggregates which can complicate HPSF and HPLC purifications.

The term synthesis scale indicates the amount of the first nucleotide of the sequence used to initiate the synthesis. This quantity defines the quantity of reagents used in the subsequent steps.
The synthesis yield is the amount of oligo isolated after the synthesis is completed; this yield is dependent on the coupling efficiency acheived in each chain extending step of the synthesis. 

 

Oligo Length Theoretical Yield
w CE 99.5% w CE 99.0% w CE 98.5%
20-mer 91 83 75
30-mer 86 75 65
40-mer 82 68 55
60-mer 74 55 41
100-mer 61 37 22

In the custom oligo order editor, enter the name and sequence of the oligo. Then you can select the modifications you want at the 5′ and 3′ using the drop down menus. For modifications in the internal positions, we recommend that you 'insert' the modification where the cursor is placed after the selecting the required modification in the dropdown menu. Please note that the designators cannot have typographical errors; we therefore recommend that you inset the internal mods. Once you place the order, these oligos will be delivered to you in tubes. For a larger volume of oligos, please use the custom oligos in plates order editor.

The table here provides the estimated turnaround time for the shipment of a standard unmodified oligo order. Please note that oligos with modifications, post-synthesis purifications or other custom services will have a different turnaround time.

Summary
Annealing protocols are fairly standard and can be found on the internet through search engines or on different company websites. The protocols are generally the same but may differ in reagents and incubation times / temperatures. Eurofins has a sample annealing protocol attached to this FAQ. The protocol may be modified or optimized to your specifications.

NOTE: Annealed dsDNA oligos should be stored at –20 °C or kept on ice when on the benchtop.

For your convenience Eurofins has an added feature when ordering through the website to have the reverse complement sequence.

Annealing Buffer: 10 mM Tris, pH 7.5–8.0, containing 50 mM NaCl and 1 mM EDTA

1x TE Buffer: 10 mM Tris, pH 7.5–8.0 containing 1mM EDTA

Step 1. Resuspending the Oligonucleotides: Resuspend both complementary oligonucleotides at the same molar concentration, using Annealing Buffer (see note below). For convenience, keep Annealing Buffer volume below 500 μL for each oligo. Annealing should perform well over a wide range of oligo concentrations. For larger scale oligo syntheses, it may be necessary to use larger volumes that can be aliquoted after resuspension.

Step 2. Annealing the Oligonucleotides: Mix equal volumes of both complementary oligos (at equimolar concentration) in a 1.5-mL microfuge tube. Place tube in a standard heatblock at 90–95 °C. Remove the heatblock from the apparatus and allow to cool to room temperature (or at least below 30 °C) on the workbench. Slow cooling to room temperature should take 45–60 minutes. Store on ice or at 4 °C until ready to use. An alternative procedure for annealing involves the use of a thermal cycler. Dispense 100 μL aliquots of the mixed oligos into PCR tubes (500-μL size). Do not overlay the samples with oil. Place the tubes in a thermal cycler and set up a program to perform the following profile: (i) heat to 95 °C and remain at 95 °C for 2 minutes, (ii) ramp cool to 25 °C over a period of 45 minutes, (iii) proceed to a storage temperature of 4 °C. Briefly spin the tubes in a microfuge to draw all moisture from the lid. Pool samples into a larger tube, store on ice or at 4 °C until ready to use.

Step 3. Long Term Storage: It may be necessary to aliquot and lyophilize the annealed sample. After drying, the sample may be stored at –20 °C in a desiccated container. Resuspend the annealed oligos at the desired concentration with sterile distilled water. The annealed pair of oligonucleotides is ready for use.

NOTE: Oligos may also be resuspended in either 1x Ligase Buffer or 1x Kinase Buffer instead of the above Annealing Buffer (prior to annealing).

Unmodified oligos can be used for at least 12 months after purchase when stored wet at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same sequence, aliquot the sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility contamination with nucleases or bacteria.

Before opening, spin the tube at 1000 rpm for 5 min to ensure that the oligonucleotides are at the bottom of the tube. Oligonucleotides should be resuspended in a sterile buffered solution (e.g., TE at pH 7.0). Vortex oligonucleotides thoroughly after resuspension. The oligonucleotides may not readily dissolve in sterile, distilled water. The addition of NaOH to the water until the pH rises to 7.0 may help. If the oligonucleotides are resuspended at pH <7.0 (deionized water may have a pH as low as 5.0), the oligonucleotide could begin to degrade and may lose functionality within a couple of weeks.

For optimal long-term storage, oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry them and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

All of the oligos synthesized at Eurofins are single-stranded DNA oligos. We do produce GeneStrands, which are linear dsDNA gene fragments, and Genes (>100 bp) after ligating and assembling these single-stranded DNA oligos. However, for oligos of length <100 nts, we do not offer dsDNA. To get dsDNA you can order the reverse complement oligo and anneal the oligos using our annealing protocol or the annealing protocol of your choice.

To confirm that the oligos annealed properly, we recommend running the annealed double-strand (ds) oligos in one lane and the single strand (ss) un-annealed oligos in two seperate lanes of a non-denaturing polyacrylamide gel 4–15%. Thaw the double-stranded (ds) DNA on ice and and run a minimum of 5 μL of ds oligo solution (0.5 μM) in lane 1, 5 uL of ss oligo solution (sense; 0.5 μM) in lane 2, and 5 μL of ss oligo (anti-sense; 0.5 μM) in lane 3. The bands in lane 2 and 3 represent the hairpin structures formed by unannealed ss oligo for the sense and anti-sense sequences ordered, and the band should run twice as fast as the ds oligo in lane one of gel. If available a 10 bp sizing ladder should be run in another lane on the gel.

The most common calculations are for Molecular Weight, Extinction Coefficient, Picomoles, Micrograms, Concentration, Melting Temperature, and Annealing Temperature. Explanations of these calculations can be found on our Calculations Page.

Mutations or alternations in sequence are rare in synthetic oligos but they can happen. Oligos may become depurinated in some positions during the synthesis process. A longer oligonucleotide is more likely to have more depurinated sites than a shorter oligo. These depurinations may become visible in applications like cloning where single molecules are selected and propagated. Typically the depurinated sites are replaced by any base. Usually only some oligonucleotide molecules are affected. If you have sequenced only one clone and found a 'mutation' in it, sequencing another independent clone will in most cases result in the correct sequence. When choosing clones, it is most important to select independent ones. To get independent clones, the pre-incubation time before plating should be based on the manufacturer instructions of your cloning system. Optimal density of the clones on the plate ensures that well separated clones can be selected.
As the risk of depurinations increases with the length of the oligonucleotide, we recommend the use of short sequences for cloning. If long oligos (>40 nt) have been used for cloning, consider increasing the number of clones that need to be sequenced. More recently, increase coupling efficiencies and accurate reagent delivery mechanims have enabled us to develop oligos with very few sequence errors. The use of these oligos—TRUEmers—can further reduce the number of mutations observed during cloning.
Please note that synthetic oligos do not contain a phosphate at the 5′-end which is necessary for enzymatic ligation reactions. However, the phosphate group can be added as a modification to the 5′-end of the oligo. If you find a 'mutation' in multiple clones please contact GenomicsSupport@eurofins.com.

For each potential position for the ester, Eurofins Genomics recommends and uses select amino modifiers as linkers. When you order an ester modification to your oligo sequence, one of these amino linkers are automatically added to your oligo, depending upon position of attachment.

5′ ester modification: Amino Modifier C6
Internal ester modification: Uni-Link amino modifier
3′ ester modification: Amino Modifier C7

Alternatively you can use AminoC6-dT.

Our customers' experiences and our internal research findings demonstrate that these amino linkers are highly reliable for conjugation and work well for the majority of experimental applications. On occasion, however, your experiment may require the fractional increase in specificity that can be achieved if you replace a T base within your sequence with the Amino C6 dT or Amino C2 dT attachments. If you would like to use either of these, please contact us through GenomicsSupport@eurofins.com.

Certain oligo modifications can only be attached to the oligo via a post-synthesis ester conjugation because a form of the modification that can be used directly on the synthesizer is not available. The reaction requires 2 substrates: (1) an oligo which contains an amino linker, and (2) the desired modification. All modifications attached through esters require HPLC purification to eliminate the unreacted substrates.

Yes. Fluorescent dye-labeled oligos are more fragile than unmodified oligos. Their ability to fluoresce will decrease over time. Before opening, spin the tube at 1000 rpm for 5 minutes to ensure the oligos are at the bottom of the tube. To ensure high quality, store the oligo dry at –20 °C in small aliquots. Note also that fluorescent dye-labeled oligos should be stored in the dark as light can slowly degrade the fluorescent moieties.
For optimal long-term storage, it is recommended that the labeled oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry all aliquots, and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

Fluorescent dye-labeled oligos can be used up to 6 months from purchase when stored dried at –20 °C in the dark.

Oligonucleotides labeled with fluorescent dyes, such as 6-FAM, HEX, TET, ROX, and TAMRA should be resuspended in a slightly basic solution (e.g., TE at pH 8.0). Cy3, Cy3.5, Cy5, and Cy5.5 labeled oligonucleotides should be resuspended at pH 7.0. Cy3, Cy3.5, Cy5, and Cy5.5 begin to degrade at pH >7.0. If brought to a pH below 7, it has been shown that the oligo can begin to degrade and may be unusable within a few weeks.

Unmodified oligos are stable molecules and can be used for at least 12 months after purchase when stored at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same sequence, aliquot the sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility contamination with nucleases or bacteria.

Per OSHA 29CFR1910.1200, Commonwealth of Australia [NOHSC:1005, 1008(1999)] and the latest amendments to the European Union Directives 67/548/EC and 1999/45/EC, Synthetic DNA does not require a Material Safety Data Sheet (MSDS). Synthetic DNA does not contain more than 1% of a component classified as hazardous and does not contain more than 0,1% of a component classified as carcinogenic. Therefore Eurofins Genomics does not provide a MSDS for Synthetic DNA. However, when working with these or any chemical reagents, we always recommend the use of gloves, lab coats, and eye protection. Eurofins Genomics assumes no liability for damage resulting from handling or contact with Synthetic DNA.

The melting temperature (Tm) of an oligonucleotide is dependent upon a number of factors including the length and G+C content of the sequence as well as the type and concentrations of cations present, particularly the sodium ion, Na+. A variety of formulas have been used for predicting melting temperatures. The following formula is recommended for oligonucleotides ranging in length from 20 to 100 residues and sodium concentrations ([Na+]) ranging from 0.01 M to 1.0 M. The Tm reported on the data sheets shipped with the oligos assumes a [Na+] of 0.1 M, the log of 0.1 is -1:

Tm = 81.5 + (16.6 * log[Na+]) + (41 * (G+C) / oligo length) – (500 / length)

It is important to remember that different websites, programs, and software may use a different equation for calculating the melt temperature of an oligo. Any calculated Tm is theoretical, and the truest method for determining the Tm of an oligo is through experimental analysis.

For a detailed breakdown on the length and synthesis scale of the oligo nucleotides, please visit the custom DNA oligos page here. For information on long oligos, go to the EXTREmers webpage. For information on double-stranded DNA fragments, go to the GeneStrands page.

Yes. The phosphodiester backbone, also referred to as the phosphor backbone, is the normal backbone for our synthesized DNA oligos. Phoshphorothiated oligos, sometimes called S-oligos, have a sulfur replacing one of the oxygens in the phosphate backbone between the bases. Oligos with phosphorothioate modification can be used to induce a strong immune response in living organisms, as they are very stable against nuclease degradation.
Here are some examples of how you can order oligos with phosphorothioate bonds):
T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (Phosphorothioate between every two contigous bases)
T*C*C*A*T*GACGTTCCTGAC*G*T*T (Phosphorothioate between only some bases and phosphodieste between others)
TCCATGACGTTCCTGACGTT (Phoshpodiester between every two contigous bases)

Eurofins Genomics strongly recommends the use of software to design DNA sequencing primers. The Oligo Toolkit and Plotter displays secondary structure as well as other useful information such as melting temperature, GC content, etc. For cycle sequencing, primer length should be between 18 and 28 bases with a GC content of at least 50%. The melting temperature of the primer should be between 50 °C and 70 °C. It is important to avoid selecting primers that form dimers or hairpins as molecules in this conformation will not participate in primer template hybridization. Additionally, if a 3′ overhang is formed by a dimer or hairpin, the polymerase will extend and form unwanted products.

 

Dual-labeled probes (fluorescence quencher or FQ probes) have a fluorescent reporter and a quencher at their 5′ and 3′ ends, respectively. These probes can be used in quantitative PCR systems that take advantage of the 5′→3′ exonuclease activity of Taq DNA polymerase. A probe specific for the sequence of interest is used together with specific PCR primers. This probe is designed to anneal between the PCR primers. During the extension phase of PCR, the 5′→3′ exonuclease activity of Taq DNA polymerase cleaves the fluorescent reporter from the probe. The amount of free reporter accumulates as the number of PCR cycles increases. The fluorescent signal from the free reporter is measured in real-time and allows quantification of the amount of target sequence. There are several design considerations to keep in mind when designing dual-labeled probes. Placement of the probe is important; the probe should be designed first, followed by the design of the PCR primers. The probe should anneal near the center of the amplicon, and the amplicon should be 50 to 150 bases long. The probe's melting temperature should be 68 °C to 70 °C. The probe should be at least 20 bases long to prevent nonspecific annealing. Finally, avoid designing the probe with a dG at the 5' terminus as dG is a weak quencher. Any dG in the primer should be at least 2 residues away from the 5' terminus.

Probe:
G-C Content: 30–80%
polyNNN: Avoid stretches of same nucleotide, especially 4 or more Gs
End Composition: No Gs at 5' end
Tm: 68–70 °C
Strand: Select strand with more Cs than Gs. If the compliment is used, make sure there are no Cs at the 3' end.
Length: Less than 30 bp
Design: Quencher on 3' end dye on 5' end

Primer:
G-C Content: 30-80%
polyNNN: Avoid stretches of same nucleotide, especially 4 or more Gs
End Composition: 5 bases at 3' end should have no more than 2 G/Cs. Try to use As at 3' end so primer dimers will be degraded more efficiently.
Tm: 58–60 °C
Product: 50 to 150 bases
Design: Choose after probe. Design as close to probe as possible without overlap. Have one primer cross one exon junction to amplify mRNA.

 

Molecular Beacons, like dual-labeled probes, have a fluorescent reporter and a quencher at their 5' and 3' ends, respectively. The sequence of these probes is designed so that they form a hairpin structure in which the fluorescent dye and the quencher are in close proximity. A Molecular Beacon specific for the sequence of interest is used in PCR. The probe is designed to anneal between the PCR primers. When the probe hybridizes to its target sequence in the PCR annealing step, the loop opens and the fluorescent reporter and quencher are separated, resulting in a fluorescent signal. The amount of signal is proportional to the amount of target sequence, and is measured in real-time to allow quantification of the amount of target sequence. In order to successfully monitor PCR, Molecular Beacons should be designed so that they are able to hybridize to their targets at the annealing temperature of the PCR, whereas the free Molecular Beacons should remain closed and be non-fluorescent at these temperatures. This can be ensured by choosing the length of the probe sequence and the length of the arm sequences appropriately. The length of the probe sequence should be such that it will dissociate from its target at temperatures 7–10 °C higher than the annealing temperature of the PCR. The melting temperature of the probe target hybrid can be predicted using the "percent-GC" rule, which is available in most probe design software packages. The prediction should be made for the probe sequence alone before adding the stem sequences. In practice, the length of the probe sequence is usually in the range from 15–30 nucleotides.

When not bound to its target sequence, the Molecular Beacon forms a hairpin structure. The proximity of the fluorescent reporter with the quencher prevents the reporter from fluorescing. During the PCR annealing step, the Molecular Beacon probe hybridizes to its target sequence. This separates the fluorescent dye and reporter, resulting in a fluorescent signal. The amount of signal is proportional to the amount of target sequence, and is measured in real-time to allow quantification of the amount of target sequence.

- Tm of probe + target hybrid (loop only) has to be 7–10 °C above Tanneal
- Tm of stem is 7–10 °C higher than the detection temperature (=annealing temperature of the PCR)
- The loop of the probe should be 15–30 nucleotides long
- The stem of the probe should be 5–7 bases on each side
- The amplicon should be less than 150 bp

If your PCR reaction used to work and then stopped, the primers or template may have become degraded. The primers can last up to 1 year if stored lyophilized and aliquoted at –20 °C. Freezing and thawing causes the primers to degrade. Primers or template can also degrade due to contamination. Millipore filtration systems, which require the filter to be changed periodically, can supply water of questionable quality at the end of a cycle. If you are using a filter system, check to see if your filter was changed soon after resuspending your oligos. You may want to consider changing the filters more often if this is the case.

Complementary primers can cause PCR artifacts, especially in control lanes (without template). The primers anneal to each other and extend, sometimes creating large products. The extra bands that appear in the control lane often disappear in the presence of competing template. Depending on the degree of complementarity, raising the annealing temperature may help if there are extra bands in other lanes.

The yield has many contributing factors. The primary reason why you might see different yields for the same oligo is that the columns are not loaded with exactly the same quantity of CPG. For example, a 50 nmol column will have a minimum of 50 nmols of 3' base available to start synthesis, but frequently has more than this amount. Keep in mind this is the starting scale and not the final yield.

The most common reason for this is that the oligos are not fully dissolved. If you resuspended in water, you may need to add NaOH to raise the pH to between 7 and 8. Oligos resuspended in water tend to have a pH of around 5, and this is often too low for them to completely dissolve. We recommend that most oligos be resuspended in TE at pH 7. We find that 10 mM Tris-HCl, 1 mM EDTA works well, but if your experiment cannot tolerate EDTA, you may use just Tris-HCl.

Oligonucleotides are most commonly quantified by measuring their UV absorbance at 260 nm. A single-stranded oligonucleotide dissolved in a neutral aqueous solution at a concentration of 33 µg/ml will have an absorbance at 260 nm of approximately 1.0 A.U. The optical density (OD) unit is defined as the absorbance (at 260 nm in a 1 cm cuvette) multiplied by the sample volume (in milliliters), so that 1 OD unit is roughly 33 µg of ssDNA.

Unlike most oligo manufacturers, Eurofins Genomics does not use liquid ammonia for deprotection. As our oligos are never exposed to ammonia they are not contaminated with ammonia salts. To increase the purity of our basic oligo further, we also desalt all oligos to remove any chemicals left from the synthesis and deprotection processes. This is why our oligos are called salt free.

When HPLC purification is ordered, several methods of HPLC purification could be used. For unmodified oligos, ion exchange purification is often performed as this method typically provides the best separation of full length oligos from the lesser products. On certain modified oligos we use reversed-phase HPLC as the modification increases the hydrophobicity of the modified versus unmodified oligos providing the best separation for these products. Two-step HPLC purification, which includes reversed-phase HPLC followed by ion exchange HPLC, is recommended for oligos longer than 70 bases.

The following chart indicates standard purification levels for different applications. For any oligo longer than 70 bases, 2-step purification methods are highly recommended. If you are unsure of which purification method to order, please consult the protocol for your intended application. Recommended purification levels:

Application Salt-Free HPSF HPLC PAGE
PCR & qPCR Primers ✔ ✔    
qPCR probes     ✔  
Multiplex PCR   ✔ ✔  
DNA Sequencing   ✔    
Microarray ✔ ✔ ✔ ✔  
Blotting ✔ ✔✔ ✔  
cDNA Library Construction ✔ ✔    
Primer Extension   ✔ ✔  
454 Fusion Primer   ✔ ✔✔  
Antisense   ✔ ✔  
Cloning (Chemical Linkers)   ✔ ✔ ✔
END Labeling & Fish     ✔  
Genotyping & SNPs   ✔ ✔ ✔  
Kinasing     ✔  
Crystallography       ✔
Gel Shift Assays       ✔
Gene Synthesis       ✔
Mutagenesis       ✔

✔ = Unmodified DNA oligo, ✔ = Modified DNA Oligos

HPSF purification produces salt-free oligos in high yields. Typical purity levels are about 70%, but no guarantee of purity is made. HPSF purity oligos can be used in any application where salt-free oligos are used, but a little extra purity is desired.
HPLC purification uses reversed-phase or ion exchange HPLC columns to produce oligos with 85%+ purity levels. It is available for a wider range of oligo types.

No. The scale of synthesis is the amount of the 3'-terminus base that the multi-step synthesis started with, it is NOT the expected final yield. The yield depends on the size of the oligonucleotide, the coupling efficiency, and the base composition. The datasheet included in each oligo shipment contains all the necessary data pertaining to that order. For PCR the 50 nmol scale yields approximately 1,000 to 5,000 reactions and the 0.2 µmol scale yields 4,000 to 20,000 reactions (100 µl @ 0.1 to 0.5 µM).

You can use 12 bp UDI sequences on MiSeq systems, but due to the limitations of the MiSeq Kit chemistry, the following adjustments are required:

  • Read both index sequences at their full 12 bp length, but reduce the length of Read 1 and Read 2 by two bases, resulting in a 2x299 bp read for the 300-cycle kit.
  • Alternatively, you can read the index sequences at 10 bp each. However, for some of our UDIs, this may result in an edit distance of 2. In such cases, ensure that demultiplexing is performed using only perfect index matches (mismatch = 0).

You can access the oligo property tool by clicking here. Please note this tool is still hosted on the legacy Operon server. We are now working to deploy this tool in the Eurofins Genomics.

Nanopore Sequencing

General Questions / Whole Plasmid Sequencing

Currently >90% of results are delivered the same day the samples are received. The exact time varies but typically it ranges between 5PM - 11PM EST.

Any number of samples is welcome. There are no minimums or limitations.

Dropboxes are available in many locations. Also, Eurofins is the only sequencing company that offers free digital shipping labels on >95% of orders. Take a look at our sample submission page for details.

The equipment vendor reports accuracy of 99.3%. The research community has reported accuracy between 93-98%.

There are pros and cons of every sequencing method. Sanger sequencing and Oxford Nanopore sequencing (ONT) are both methods for determining the sequence of nucleotides in a piece of DNA. Typically Sanger is consider the most accurate method for short-read sequencing and NGS is better for long-read sequencing.

Overall, the choice between Sanger sequencing and ONT will depend on the specific needs of the application. Both methods have their strengths and limitations, and the appropriate method will depend on factors such as the length and quality of the DNA sample, the desired level of accuracy, and the cost and availability of the necessary equipment.

 

Pros

Cons

Short read sequencing

(Sanger)

  • Widely used and well-established method
  • High accuracy and precision
  • Can be automated for high-throughput sequencing
  • Chromatogram makes it easy to visually interpret results
  • Limited read length (typically up to 1000 base pairs)
  • Requires relatively large amounts of high-quality DNA
  • Requires reassembly for covering longer regions.
  • Difficult to sequence repetitive regions without gaps and resolve large variations.

Long read sequencing

(Whole Plasmid)

  • Long read lengths (up to several hundred thousand base pairs)
  • Can sequence a wide range of sample types, including low-quality and degraded DNA
  • No primer design required
  • All data from one sample

 

  • Lower accuracy compared to Sanger sequencing, particularly for shorter reads
  • More expensive per base pair compared to Sanger sequencing
  • ·Cannot resolve single bases.

Absolutely. Using our free barcode labels is not required, but always an option.

Absolutely, yes.

It is easy. Go to our online ordering page.

Place order

We will be rolling out the new order page across portal sites, marketplaces, and punchouts very soon. At the moment, please submit orders on the main www.eurofinsgenomics.com website.

Go to the data deliverables webpage for a complete breakdown of all the file types with images. 

It really depends on the sample quality. We cannot guarantee the level of coverage at this time. A good sample submitted properly will typically yields hundreds or even thousands of sequencing reads. Consensus coverage depends on how many reads are full-length plasmids and how many, if any, degraded.

The probability of failure is low when using WPS, although it can still happen. If you wish to resequence a failed sample, contact Genomics Support. Our decision to charge or not for resequencing depends on the context.

If there is sufficient evidence to show the root cause was on our side, we will take full accountability and rerun the samples for free.

If there is sufficient evidence to show the root cause was likely in the material, we must charge for resequencing since it requires more time and energy than a normal to pull the samples and run them on the machine.

If the root cause is unknown, we typically will rerun 10% of the order for free to test it. If there is a significant improvement in the new results, we will rerun the rest. If there is not a significant improvement, the customer can choose to pay to rerun the remaining samples. Standard sequencing prices apply.  

A maximum of two reruns are allowed. If the samples fail after two times, we advise the customer to either send a new sample or troubleshoot the sample from their end.

The process is almost identical between Whole Plasmid Sequencing and Amplicon Sequencing.

  1. Ordering is the same, using the same order pages.
  2. Results are the same, with Amplicon sequencing offering all the same file types.
  3. The sample submission guidelines is the same for both.
  4. The turnaround time is generally the same.

It really depends on the sample quality. We cannot guarantee the level of coverage at this time. A good sample submitted properly will typically yields hundreds or even thousands of sequencing reads. Consensus coverage depends on how many reads are full-length plasmids and how many, if any, degraded. Generally speaking, the coverage for linear/amplicon samples is similar to whole plasmid sequencing.

You can send it and we can sequence it, but we cannot predict or promise the analysis outcome. The customer would take on the risk of these orders.

Prevalent error patterns in Oxford Nanopore sequencing often manifest as deletions within homopolymer stretches and inaccuracies occurring specifically at the central position of the Dcm methylation site, CCTGG or CCAGG. Anticipated advancements in sequencing chemistry and basecalling software updates are poised to ameliorate these limitations in the foreseeable future.

The assembler occasionally encounters challenges in reconstructing the terminal ends of linear DNA, potentially leading to the omission of approximately ~25 nucleotides from the 3' and/or 5' ends of your insert, contingent upon your sample's sequence. Should you observe this occurrence, you have the option to download the raw reads from your Dashboard and employ your preferred methodology to reconstruct the ends.

Bacterial Genome

Typically 2 days. If extraction is required, the turnaround time is 1 week. In rare instances, it may take longer depending on the complexity of the project and the volume of samples being processed.

The process is almost identical. Go to the normal order page and you will see an option to select bacterial genome in second step of the order process.

The minimum targets for successful sequencing can be found on the bacterial genome webpage. In short, the target is 30x coverage which equates to 210 Mb for medium size samples and 360 Mb for the larger size.

Should your genomic DNA (gDNA) extraction encompass native plasmid DNA, it is likely that corresponding sequencing reads for these plasmids will be obtained. The standard sequencing procedure typically excludes input DNA fragments smaller than 3kb. However, we do not selectively filter out diminutive plasmid-sized reads during the assembly process. Consequently, it is probable that these smaller reads will contribute to the creation of distinct plasmid assemblies alongside the overarching gDNA assembly. The ultimate outcome, determining which DNA types within your sample contribute to the assembly, hinges on factors such as overall sample quality, coverage, and the relative abundance or degradation of each DNA type.

Go to the data deliverables webpage for a complete breakdown of all the file types with images. 

If none of the targets set for successful sequencing are met, then our technicians will evaluate the results to determine the feasibility of achieving a more successful outcome a second time. If there is potential for success, typically a repeat is run at no additional cost. Customers may submit a repeat request for evaluation as well. However, should the desired outcomes not be attained during the second attempt, or if our technicians determine that the potential for success in a second run is low, then further repeats will not be initiated. Should you opt to sequence the sample anew, it is imperative to prepare fresh samples that adhere to all quality control (QC) requirements before submitting a new sequencing request.

This service is designed for the analysis of clonal populations, specifically a single species of bacteria. While it is permissible to submit mixtures of different bacterial species for sequencing, predicting the assembly outcome is challenging, and therefore, it is undertaken at your own risk. The total raw data acquired for your sample will be proportionally allocated among the different species present. Consequently, this division diminishes the individual genome coverage of each species, potentially impeding the assembly of specific species within the sample. Re-sequencing mixtures does not alter the relative proportions of the species. However, if higher total coverage is needed, multiple aliquots can be submitted. The ultimate determination of which species yield an assembly depends on the overall sample quality, coverage, and the relative abundance or degradation of each species.

Certainly, any species is technically amenable to sequencing and assembly using this method. However, it is essential to acknowledge that submitting samples for applications beyond bacteria entails inherent risks. This is due to the fact that we have not fine-tuned the optimal data requirements for various specimen types, and our assembly/annotation pipeline is primarily tailored for bacteria.

For non-bacterial applications, there may be a necessity to submit multiple aliquots of each sample to ensure adequate genome coverage for larger and more intricate eukaryotic genomes. It is important to highlight that data from all aliquots must be amalgamated before initiating your assembly pipeline.

In the event of planning to submit a substantial number of samples for such off-label applications, we strongly recommend reaching out to us prior to submission. This proactive communication will facilitate discussions on viable options and ensure a more informed approach to meet your specific requirements.

Oxford Nanopore touts accuracy of 99% raw read accuracy. The scientific community has reported results ranging from 93-98%. Final assembly is contingent upon both coverage and data quality. A higher coverage, denoting an increased number of reads used to construct a consensus, typically augments the accuracy of the obtained results.

Sanger Sequencing

General Questions

Go to your Order History. Next, click an order to expand and reveal the download link. To visit the Order History page, click one of the many links located throughout the website, including in the header beside your account information, the main menu, and the order now menu.

If you remove the hyphen in the barcode number, it should work fine. Barcode numbers can only contain digits in the new system. Entering a hyphen, space, period or other invalid character will cause problems.

The probability of failure is low, although it can still happen. If you wish to resequence a failed sample, contact Genomics Support. Our decision to charge or not for resequencing depends on the context.

If there is sufficient evidence to show the root cause was on our side, we will take full accountability and rerun the samples for free.

If there is sufficient evidence to show the root cause was likely in the material provided by the customer, such as the sample or primer, we must charge for resequencing since it requires more labor and reagents to run them again.

If the root cause is unknown, we typically will rerun 10% of the order for free to test it. If there is a significant improvement in the new results, we will rerun the rest. If there is not a significant improvement, the customer can choose to pay to rerun the remaining samples. Standard sequencing prices apply.  

A maximum of two reruns are allowed. If the samples fail after two times, we advise the customer to either send a new sample or troubleshoot the sample from their end.

To share your results, go to your order history page, open the sequencing order that you wish to share, and click the small square icon on the right side. It will open a new tab/window with order details. Look for the option to forward results at the top of this new page.

At one point in the past, a link to download your sequencing results was included in the delivery email once the results were ready. However, that link is no longer posted in the email for security reasons. To download your results, simply log into your account, go to My Orders and download the results from the order history menu.

All information on how to ship your samples is on the shipping samples webpage. All information on preparing samples is on the sample submissions guidelines. Troubleshooting poor results can be found on the sequencing support webpage.

SimpleSeq Kit Questions

Besides ensuring that the samples submitted in the Barcode Labeled tubes for the SimpleSeq kits are shipped securely, there are several other benefits that you get when you get a SimpleSeq kit. These include the ability to share these kits easily with your colleagues/team members, ability to submit sample quantity for up to 4 reads in a single tube, ability to monitor the usage of sequencing reactions usage, ability to activate your kit, and the ability to add sequencing reactions to your kit using FlexPacks or FlexReads. Furthermore, now you can do all these on our e-commerce site; you do not have to call our Genomics Specialists for any of these activities.

If the Webless or the Standard kit(s) has been purchased under your account, you do not have to do anything. The kit is automatically added to your account and you will see the kit listed in your Sequencing Dashboard. You can place orders without having to manually activate the kit. Please note that this is change from the previous process wherein you had to manually activate the kit before placing the orders.

After you handover the unused SimpleSeq kit to your colleague, you can either 'assign kit' to him/her, or ask him/her to 'activate kit'. Please note that, as the giver, you will have to 'assign' the kit (see instructions below), while he/she, as the 'receiver' will have to 'activate' the kit (see instruction below) to ensure that the kit and the prepaid reactions are added to end-users online account. Please note that once a kit is assigned (or activated by the recipient), the kitcode and the associated reactions will be removed from your sequencing dashboard and transferred to the recipient dashboard.

SimpleSeq Kits are now auto-activated. Meaning, the kit is automatically added to your account when shipped. The kit will appear in your sequencing dashboard. There is no need to manually activate it.

A SimpleSeq Kit will be automatically shared when your colleague(s) orders a tube sequencing services with the sample submitted in the barcoded tube from your kit. Sharing indicates that the kit and its component barcoded tubes (used, in use, and yet to be used) can be viewed from your and your colleagues Sequencing Dashboard. Each members sharing a kit can view the purchased and user of each barcodes tube belonging to that kit. Moreover, you can also share a kit with your colleague by using the 'Share Kit' feature in the sequencing dashboard page:

  1. Go to the sequencing dashboard
  2. Click on 'Share kit' located on the side bar to open the interface
  3. Enter the Kit barcode number that you want to assign
  4. Enter the username (log in name at www.eurofinsgenomics.com) of the assignee
  5. Hit 'Share Kit'.
  6. Your colleague can now view the available number of barcoded tubes or sequencing reactions from their sequencing dashboard and plan their experiments or order sequencing services accordingly.

When you 'share kit' with your colleague(s), the number of available reactions will be displayed on the sequencing dashboards in both your accounts. When either of you use a reaction, the number of used reactions will be deducted from each of your accounts in the sequencing dashboard.

 

As an owner/purchaser of SimpleSeq kits, you can physically distribute the kits to your colleague, co-worker, or your lab member and then 'assign' the kit to them online or ask them to 'activate' the kit. When you assign a kit using the sequencing dashboard, the kit, along with the barcodes of the tubes contained within the kit, is automatically transferred to asignee in our Barcode Management System; this makes the sample submission process easier for the assignee. To assign a kit:

  1. Go to the sequencing dashboard
  2. Click on 'Assign kit' located on the side bar to open the interface
  3. Enter the Kit barcode number that you want to assign
  4. Enter the username (log in name at www.eurofinsgenomics.com) of the assignee
  5. Hit 'Assign Kit'

When you assign a kit, your account will no longer display the kit details in your account; instead the barcodes associated with the kit and the tubes will appear in the account of the assignee. If you want to simply hand over the kit to your student or colleague, you can ask him/her to 'activate' the kit. Such activation will ensure that the barcodes associated with the kit are transferred to his/her account and will be identified when he/she places a sequencing order and not be charged for the same. Please note that you can only assign the kit when have not yet used a single tube. If you would like to distribute barcode labeled tubes to your colleagues after having used up a few to submit your samples, please see share kit.

 

Yes, all SimpleSeq kits require an online order. Users must enter the barcodes on the side of the SimpleSeq tubes into the tube sequencing order page. Using the barcodes will ensure that you are not charged for these reactions. Next, assemble your samples and primers for physical submission. Lastly, FlexReads are virtual reactions that can be used to "refill" a SimpleSeq kit when the kit reactions are exhausted but there are tube barcodes remaining. FlexReads do not have barcodes. The system will automatically pull from your stock of FlexReads when submitting SimpleSeq barcodes that have no more reactions.

With this update, we have a sequencing dashoard which displays all the barcodes, SimpleSeq kits and tubes barcodes, associated with your account. This dashboard will allow to manage your sequencing resources effectively. Please provide your feedback if you need additional features on this dashboard. 

Excel template and ordering sequencing services related questions

Traditionally, we did collect the size of each sample. This was a rather tedious process for you and most of our order contained samples of similar sizes. To reduce the amount of time you invest in placing a sequencing order, we have taken steps to make the ordering process simpler. Our laboratory requires the template size in two independent scenarios (both related to PCR Products):

  1. Power Read sequencing service: this size of the PCR products helps in pipetting out the required volume for the desired concentration.
  2. Quality Assurance: each sequence is verified by a Quality Control specialist before the results are available for your viewing. A sequence terminated early can either indicate a failure of the sequencing reaction or indicate a sample with a short template size (e.g., PCR product with <300 bps). The provided size is then used as a reference for the QA.

In all other cases, when the samples are prepared based on the sample preparation guidelines, the size of the sample does not play any role in us being able to offer our services to you.

You can use the Plate Sequencing template (available here). Please select mix of both as the sample type.

With the recent upgrade in the Eurofins Genomics web portal, there have been several changes that can impact the template upload process. The following are the most likely reasons for the failure in uploading.

  • Incorrect template: the wrong excel template is being uploaded. New templates have been prepared for each plate sequencing order editor. Ensure that the relevant filled excel template is being uploaded. Please do not use excel templates from the legacy Operon site.
  • Altered Text Fields: The validation parameters in the order controls are tailored for the texts in cells with blue background. When these texts are edited or changed, the validation fails and the template will not be validated. Please refrain from making any edits on the pre-poplulated cells.
  • Invalid characters: Most fields in order control UI have been configured to accept alphanumeric characters. Avoid using special characters, e.g., #, @, %, etc., in the names of your primers or samples.

In the excel templates for plate sequencing services, each worksheet represents a sample-containing plate. The names of the sheets are Plate 01, Plate 02, etc. To provide a custom name for your plate, edit the name of the excel sheet. Remember to label your plate legibly using a marker or paste a free barcoded label to the bottom of the plate.

Technical questions

The average read length for a standard sequencing read from one direction (one sample, one primer) is 750-1000 bps.

This is because your account ran out of reactions associated with that kit. With each SimpleSeq kit, 96 sequencing reactions with Standard read conditions are provided. Nevertheless, you can use more than 96-reactions when you use multiple reactions (using different primers) for a sample submitted in a single tube. Consequently, when you run out of reactions but have unused tubes to submit your samples, the 'extra' sequencing reactions are charged at $5.00/sequencing reaction.

Yes, we do! Our PowerRead service is specialized for difficult regions like GC rich regions, repeats or secondary structures etc. It is available on all tube sequencing products except for SimpleSeq Premixed. A PowerRead fee is charged per reaction.

Unfortunately, we do need offer dilutions on Samples availing our Standard chemistry for sequencing. However, our Power read service can take care of this request. We offer sample quantitation and adjustment to the recommended range with this service.

Yes, we do! We store your samples and enclosed primers for 5 days by default. If you like to have the sent primers stored for 30 additional days, please indicate the same while placing the order. Please note we store the synthesized primers for 6 months. See the primer management tool for more details (will require login).

Please note that we treat each sample with utmost care, nevertheless, unexpected events in our lab can sometimes lead to bad sequencing results. We will inform you in such scenarios. Meanwhile, the actions you can take to ensure that you get best the sequencing data when ordering a Ready2Load Plate sequencing service are the following:

Possible Cause(s)

Recommended Action

Loss of labeled product during purification of extension products.

Review protocol for post-reaction dye terminator removal and ensure that all reagents are at the correct concentration and ethanol solutions are prepared fresh daily

Thermal cycler malfunction

Determine with the manufacturer how to test your thermal cycler for proper performance.

One of the components of the sequencing reaction (template, primer, or Ready Reaction Mix) was either omitted, was the wrong material, or was of poor quality.

Review the entire experiment carefully.

1. Check the quantitation and quality of the sequencing reaction components.

2. For each component, replace the component, perform a sequencing run, then evaluate the results until you have identified the problem or replaced all of the reaction components.

3. Run a DNA template control to determine whether the sequencing reaction failed or the template quality is low.

Insufficient template added to sequencing reactions, leading to too few sequencing products generated during PCR.

Check DNA quantitation and quality

Template contains sequencing inhibitors such as phenol

Follow recommended procedures to prepare templates. Check DNA quality. If necessary, clean up dirty templates.

No enzyme activity because Ready Reaction Mix was stored improperly or it separated upon storage.

Check the color of the Ready Reaction Mix. If the color is not uniform, the Ready Reaction Mix separated upon storage. Mix the Ready Reaction Mix gently before using it. Run a DNA template control to test enzyme function

Weak priming because of poor primer design.

Review primer design: Make new primers, then repeat the sequencing experiment.

There was no problem with your sequencing reaction. The sequence of the primer is not expected to be returned in the sequence data; furthermore, you will also notice that the initial 20-40 bases following the 3′ end of the primer are not determined accurately due to poor resolution. This is consistent with the behavior expected with Sanger method of sequencing. However, the sequence of the primer is typically determined by using a primer to sequence the complimentary strand. By assembling the two reads, a consensus sequence can be generated that includes segments corresponding to both the primer sequences.

Please use the same sample (and barcode) twice on the order form and enlist the respective forward and reverse primers against it. Thus, there would be two line items. You can submit the sample in just one tube as per our sample submission guidelines.

We cannot sequence FAM- and ROX-labeled Samples. Fluorescence from the dyes will interfere with the sequencing results. Please note that we do sequence samples containing the SyBR Green dye—our PCR clean-up service can remove them from the sample. Please indicate the additional service when you place the order.

Yes, our Standard sequencing chemistry can read dUs in the sequence. Please note that dU is read as dA in the Sanger method of Sequencing and treated as modified DNA base. If there are repeats of dUs in your template sequencing, we recommend the use of Power read sequencing service.

Unfortunately, we do not offer RNA sequencing services. On account of the presence of the 2′-OH group, RNA is relatively more unstable when compared to the DNA with same sequence; RNA is susceptible to cleavage by RNases. To sequence your RNA samples directly, please reach out to appropriate service provider.

DNA Sequencing Troubleshooting Guide

Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry stabilizes.

Examples:

Toubleshoot1

Sequence Appearance:

  • Chromatogram data looks messy or is mostly blank.
  • Many "N's" in the sequence, if bases are called at all.
  • Blast search from .seq or fasta file yields unexpected results.
  • Raw data has signal intensity in the low hundreds.

Examples:

Seq Improving1

Possible Causes:

It is difficult to pinpoint a specific cause for the failure when there are no data for review. Common causes are:

  • DNA Template concentration is too low – Note: measuring DNA concentration by UV absorption is often inaccurate and concentration is frequently overestimated. Agarose gels are a better method to estimate quality and quantity of DNA samples.
  • Wrong primer or no primer was added to the reaction – binding between the DNA and the primer cannot occur in either of these instances.
  • Low quality prep – yields incomplete removal of protein and/or RNA, or buffer salts or other chemical contamination may be present. Any of these conditions can inhibit sequencing reaction enzymes.

Treatment:

  • Check the concentration of your template by agarose gel to ensure that it falls with the ranges listed in the Sample Submission Guidelines.

  • Check the primer sequence against the template sequence to ensure that there is a proper building site.
    a) Prepare fresh stock options for the template prep and dilution just prior to submitting samples.
    b) Prepare plasmid DNA using a commercial mini-prep kit.
    c) A final ethanol precipitation after the prep may help to ensure success.

Sequence Appearance:

  • Sequencing peaks are not Multiple peaks with the same height or of differing heights, overlapping one another.
  • Raw data has adequate signal intensity, indicating that the double peaks are not due to weak signal and/or background noise.

Seq Improving2

Possible Causes:

  • Clone contamination – in this case, the beginning of the sequence is often clean and becomes "dirty‟ as the progresses past the clone insertion site.
  • PCR template may be heterozygous due to indels present in a diploid (or polyploid) organism.
  • Two primers may have been mistakenly added to the sequencing reaction.
  • PCR products were not purified (or the purification was not performed properly). In this case, residual PCR primers may participate in the sequencing reaction.
  • There may be enough homology in another area of the template that where the sequencing primer begins extension.

Treatment:

  • If clone contamination is expected, please return to your clone resource and replate the bacteria onto selection media. You may want to select up to 12 clearly separated clones for sequencing to ensure you find the actual clone of interest.
  • Where PCR template heterozygosity is suspected, examination of the some indication of the area of heterozygosity. Newly designed PCR primers that yield shorter products may allow you to discern where the troublesome area is. Alternatively, you may decide to redesign the sequencing primer close to the area where the problem first arises hoping to find a primer that will sequence one of the product species. If the PCR product is large, subcloning the template into shorter pieces may also provide a strategy for discerning the true sequence of the area of interest.
  • When you suspect that two different primers may have been added to the reaction, you can simply repeat the reaction. If the working solution for the sequencing primer may be contaminated then going back to your original uncontaminated stock solution to prepare a new working solution or resynthesize the primer.
  • Check your PCR purification protocol and the solutions used in the clean-up reaction.
  • Check the primer sequence against the template sequence to ensure that there is a single binding site. Where sequence is unknown, you may need to switch to a different sequencing primer to eliminate the problem.

Sequence Appearance

Background noise and odd peaks are present underneath the main sequence peaks.

Example:

Troubleshoot5

Possible Causes:

  • Clone contamination – in this case, the beginning of the sequence is often clean and becomes "dirty‟ as the sequence progresses past the clone insertion site.
  • PCR template may be heterozygous due to indels present in a diploid (or polyploid) organism.
  • Two primers may have been mistakenly added to the sequencing reaction.
  • PCR products were not purified (or the purification was not performed properly). In this case, residual PCR primers may participate in the sequencing reaction.
  • There may be enough homology in another area of the template that where the sequencing primer begins extension.
  • If clone contamination is expected, please return to your clone resource and replate the bacteria onto selection media. You may want to select up to 12 clearly separated clones for sequencing to ensure you find the actual clone of interest.
  • Where PCR template heterozygosity is suspected, examination of the some indication of the area of heterozygosity. Newly designed PCR primers that yield shorter products may allow you to discern where the troublesome area is. Alternatively, you may decide to redesign the sequencing primer close to the area where the problem first arises hoping to find a primer that will sequence one of the product species. If the PCR product is large, subcloning the template into shorter pieces may also provide a strategy for discerning the true sequence of the area of interest.
  • When you suspect that two different primers may have been added to the reaction, you can simply repeat the reaction. If the working solution for the sequencing primer may be contaminated then going back to your original uncontaminated stock solution to prepare a new working solution or resynthesize the primer.
  • Check your PCR purification protocol and the solutions used in the clean-up reaction.
  • Check the primer sequence against the template sequence to ensure that there is a single binding site. Where sequence is unknown, you may need to switch to a different sequencing primer to eliminate the problem.

Sequence Appearance

Sequencing data quality is poor after stretches of 7 or more nucleotides of the same base.

Example:

Troubleshoot6

Possible Causes:

  • Polymerase slippage during DNA synthesis. This is a recognized limitation of the Sanger method.

Treatment:

Options to go around the stuttering artifact are:

  • Sequence from the reverse direction.
  • Use a poly-mononucleotide primer with a degenerate base (wobble) at the 3′ end of the primer.

 

Sequence Appearance:

The DNA sequence suddenly stops or peak intensity drops off substantially. NOTE: Many popular cloning vectors have palindromes flanking their linker and may show the drop-off effect when sequenced. This is a limitation of the Sanger method, but it can many times be overcome with PowerRead technology.

Example:

Troubleshoot7

Possible Causes:

  • Secondary structures in the DNA template (e.g. hairpin loops, palindromes)
  • GC or GT rich regions
  • Sample is an siRNA construct

Treatment:

  • Power Read technology yields excellent results with these template types.

 

Sequence Appearance

Sequencing signal gradually drops off

Example:

Troubleshoot8

Possible Causes:

  • Excess DNA template or primer.
  • GC or GT rich template (from bisulfide treated DNA, for example)

Treatment:

  • Carefully quantify your DNA template and primer prior to sequencing.
  • Sequence from the reverse direction.
  • Use a poly-mononucleotide primer with a degenerate base (wobble) at the

Sequence Appearance:

Sharp, high-intensity, multicolored peaks that randomly appear in the sequence

Example:

Troubleshoot9

Possible Causes:

  • The cause of spikes is not completely understood. One possible explanation is that an impurity or micro bubble passes through the camera view of the sequencing instrument, scattering light.

Treatment:

  • The surrounding sequence should still be correct and accurate if of good quality, please request your sample to be rerun if necessary.

Sequence Appearance

Peaks become broad or oddly shaped very early on in the sequence.

Example:

Troubleshoot 10

Possible Causes

  • Salt or other impurities carried over from DNA isolation protocols, protocols.

Treatment

  • Use a commercial desalting kit to further purify the DNA template before sequencing.

Gene Synthesis

Yes. You can select specific 3′ and 5′ restriction enzymes from the drop down menu of the Gene Synthesis Ordering Wizard. The wizard will automatically add the appropriate DNA sequences to your gene. The complete gene sequence with restriction sites will be displayed for your review prior to moving your genes into the Shopping Cart.

We can synthesize sequences or complete genes from very short fragments up to several thousand base pairs in length. As each synthetic gene project is unique, we'll be able to provide more information when you contact us for a quote.

Eurofins utilizes GENEius™ sequence optimization software, when requested, to optimize all aspects of your synthetic gene. You enter the amino acid or DNA sequence and GENEius software optimizes your construct in 4 dimensions:

• Codon optimization
• Secondary structure avoidance
• GC content optimization
• Bad motif avoidance

We believe that our optimization will result in better protein expression. But, to be absolutely certain we compared our optimized sequences with those optimized with other software packages. Download our White Paper to see the results.

Due to limitations in oligo synthesis chemistry and other practical considerations, oligos are produced as mixture of single-stranded DNA strands and are limited in length to ~200 nucleotides. Synthetic genes, however, can extend to several thousand, double-stranded base pairs. Usually created as a sequence verified clone, these constructs may be the best tool for your research needs.

A gene that has been cloned into a vector has been fully sequenced and confirmed to have 100% sequence identity to the expected sequence; a PCR product represents a mixture of correct and incorrect sequences due to errors incorporated during polymerase chain reaction. As a consequence of this property of polymerase, subclones created from the original confirmed clone may show variation from the expected sequence. Whenever you use cloning methods that incorporate PCR products for your cloning experiments, we recommend sequencing at least 6–12 colonies to identify one with the expected sequence.

When Eurofins Genomics delivers your cloned gene and any additional plasmid preps ordered by you, you will receive materials with the 100% correct sequence and a dried vector with the gene insert of a 100% correct clone.

Yes, Eurofins Genomics will create your gene in as many vectors you may choose. One popular example is for customers to order a standard clone, a second construct in a shuttle vector and also a third clone in an expression vector.

A vector is a plasmid or small strand of DNA into which a non-native DNA fragment (usually a synthetic gene) can be inserted via restriction enzyme treatment followed by ligation. Cloning vectors are utilized primarily for the replication of the gene insert. Expression vectors on the other hand are genetically engineered to enhance and promote the transcription of the gene insert to facilitate the expression of large amounts of its recombinant protein within the host cell. Besides the presence of expression signals most expression vectors can be distinguished from cloning vectors by the presence of protein tags. Most of these tags are used to help in the purification of the recombinant protein from the proteins of the host cell.

Protein tags are peptide sequences appended to recombinant proteins to modify them for various post-translational applications. There are numerous types of protein tags for different applications. Some protein tags can be used in tandem to confer dual functionality. The following are a few examples of the uses of protein tags.

• To aid protein folding in chaperone-deficient hosts (solubility tags)
• To facillitate protein purification by changing chemical characteristics of the recombinant protein (affinity tags)
• To label recombinant proteins (fluorescent tags)

No. We do not provide protein-tagged vectors. If you would like a protein tag incorporated into your vector, you can either send Eurofins Genomics your protein-tagged vector and we will insert your synthetic gene into it or you can add the protein tag sequence to your gene sequence.

Yes. You can insert protein tag sequences into the 5′ and/or 3′ untranslated regions (UTRs) on the wizard. The UTRs are not optimized by GENEius software.

We verify each synthetic gene using DNA sequencing of both strands and ensure 100% sequence accuracy for every synthetic gene. Our gene synthesis lab maintains the highest quality standards throughout the complete synthesis process. The quality management system for our Louisville, Kentucky facility has been certified to ISO 9001:2008 and ISO 13485:2003 standards.

The standard delivery times are:

For Standard Genes (160–1,000 bp): 6 working days
For every additional ~950 bp: +5 working days
For Complex Genes: Please inquire
Additional subcloning into customer vector: 5–10 working days

Click on the Order Now button to bring up the Gene Sythesis Ordering Wizard. This wizard will guide you through the process of entering your gene information, optimizing your gene sequencing, and selecting the proper vector and preparation scale. Upon completion of the wizard, your gene is placed in your Shopping Cart. After you have entered and optimized all of your genes, a simple checkout process will place the order with our lab.

Among the many uses for synthetic genes are adapting codon usage for optimizing gene expression, for protein over-expression and/or protein engineering; as standards for Real Time PCR and standard PCR, mutagenesis studies, to construct hybrid genes, and the production of DNA vaccines.

The formation of potential hairpin structures of 4 or more bases should be avoided within your synthetic gene sequence. Also, sequences that are commonly associated with poor oligo quality such as long stretches of single or di-nucleotide repeats, or high GC content should be avoided. To achieve high levels of gene expression (protein production), we also recommend that you avoid sequences that introduce rarely used codons into a gene.

Our proprietary GENEius sequence optimzation software will optimize your gene, even if your original sequence contains some of the problem sequences listed above. Even many native gene sequences benefit from optimization in addition to codon optimization for a non-native host.

There are three different approaches for the assembly of synthetic genes. In the approach developed by Khorana (Gupta et al., 1968), a series of sequentially overlapping oligonucleotides are synthesized. As the complementary sequences of the oligos anneal, double-stranded DNA fragments containing nicks on both strands are formed. The nicks are repaired with DNA ligase, an enzyme that catalyzes the formation of a phosphodiester bond between the 5′-phosphate of one double-stranded oligo fragment and the 3′-hydroxyl terminus on an adjacent double-stranded oligo fragment.

Another broadly used approach is the one developed by Narang (Scarpulla et al., 1982) making use of the template-directed and primer-dependent 5′ to 3′-synthesis capability of the large subunit of the enzyme DNA-Polymerase I (Klenow fragment). After end-to-end annealing of the oligos, Klenow uses deoxynucleosidetriphosphates to fill the gaps. Treatment with DNA ligase repairs any nicks in the resulting, double-stranded DNA.

An alternative strategy has been developed, using very long oligonucleotide chains. In this approach (Rossi et al., 1982), two long oligos are synthesized and upon annealing, their 3′-ends will overlap. The construct is completed to a full length double-strand using a DNA polymerase to fill in missing bases. After treatment with the polymerase, overhanging ends are generated on the double-stranded fragment by digestion with the appropriate restriction enzyme.

Typically all of these methods are followed by the molecular cloning of the gene into an appropriate vector, so technical limitations of subsequent cloning steps must be considered while developing the assembly strategy. For example, assemblies for larger genes may be divided into sub-assemblies which are sequenced to confirm 100% identity and then brought together to complete the full construct which receives a second round of sequencing to verify the full assembly.

When you need the mutations to be distributed across the whole gene, we recommend de novo synthesis. De novo synthesis allows you an opportunity to also optimize features of the gene such as codon usage, GC content, restriction sites, etc. Site-directed mutagenesis is best used when the modifications are few, or are clustered in a small area of the gene.

// start - Hubspot script file load and caching fo 15 days // End - Hubspot script file load and caching fo 15 days