Oligonucleotides are short strands of DNA or RNA molecules that are widely in research, forensics, and genetic testing. The use of the word oligo has widely replaced the use of 'DNA oligonucleotide'. The term oligonucleotide is derived from the Greek word 'oligo', which means few, and nucleotide, which indicates the building blocks of nucleic acids. These oligos, which can have custom sequences, are chemically manufactured and sold to researchers. While typically oligo is used as a prefix to indicate a few, the limits in case of oligonucleotides have not been precisely defined. Eurofins Genomics has chemically synthesize oligomers of lengths ranging from 5 to 200 nucleotides (nt).

Customers who are new to handling large quantities of material may be surprised to notice a yellow or brown tint in their oligos. If this happens, there's no need for concern. Color variation is a typical occurrence in custom synthesis, particularly as concentrations rise. It's important to note that IDT does not anticipate any impact on the function of oligos in experimental applications due to this color change.

The image above illustrates the normal color variation observed in oligo pools at the same concentration (200 nmol oligos in 15 mL solution). Generally, modified oligos at larger scales are more likely to show this color variation, while smaller, unmodified oligos (e.g., 25 nmol) typically remain colorless in solution.

Overall, synthetic oligos vary in appearance depending on a large number of factors. The lyophilized oligo may appear dry or oily with a clear, white, or brownish color. High concentration may also add color, as covered above. In conclusion, a colored product is not a sign of impurities and should not be a cause for concern. All of Eurofins Genomics’s oligo products meet strict quality control standards before being shipped to our customers.

Unmodified oligos are stable molecules and can be used for at least 12 months after purchase when stored at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same oligo, aliquot the oligo sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility of contamination with nucleases or bacteria.

Eurofins Genomics oligos are always shipped salt-free. Before opening, spin the tube at 1000 rpm for 5 min to ensure that the oligonucleotides are at the bottom of the tube. It is recommended that the oligonucleotides be resuspended in a sterile buffered solution (e.g., TE at pH 7.0). Please vortex your oligonucleotides thoroughly after resuspension. The oligonucleotides may not readily dissolve in sterile, distilled water. If NaOH is added to the water, the pH will rise to 7.0 and this should help. If the oligonucleotides are resuspended at pH <7.0 (deionized water may have a pH as low as 5.0), the oligonucleotide could begin to degrade and may lose functionality within a couple of weeks.
For optimal long-term storage, it is recommended that the oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry them and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

Eurofins Genomics uses the industry standard beta-cyanoethyl phosphoramidite chemistry (Caruthers, M. H., 1983, Tetrahedron Lett. 24:245–248) to synthesize oligonucleotides in the 3′ to 5′ direction. For a more granular overview, click here. This chemistry has been proven to be robust and to yield high-quanlity oligos. Different high-throuput synthesizers coupled to different synthetic protocols are used for the synthesis of a range of oligonucleotide products.

NGS Grade is selected from the purification dropdown menu on the oligo order pages.  It is available on the custom DNA oligo tube and plate order page, as well as the EXTREmer tube and plate order page.

HPSF stands for High Purity, Salt Free. This is a proprietary cartridge-based purification method that provides a highly pure oligo.
Eight elution steps, including in situ cleavage of the dimethoxytrityl (DMT) protecting group, ensures that nearly all n-x oligomers, protecting groups, and salts are washed away.

Once the oligo is synthesized and washed, we perform the following analytical tests:
a) OD measurement
The final yield of the oligo is calculated based on the optical density (OD) measurement. The absorbance at 260 nm is recorded. One OD unit of DNA is the amount of DNA in 1.0 mL of ddH2O that gives an absorbance reading A₂₆₀ = 1.0 when measured using a 1 cm quartz cuvette. 1 OD typically corresponds to ~33 μg/mL of ssDNA.
b) MALDI-TOF MS
The identity of each oligo is verified by mass-spectrometry. Analysis by Matrix Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) is the default method of choice for most of the oligo synthesized by us.
c) Capillary Gel Electrophoresis (CGE)
Analysis by CGE is routinely performed on unmodified oligonucleotides (>60 nt long) which have been purified by RP-HPLC.

Over the years, Eurofins Genomics has identified few sequence-dependent features that can make the production of the oligo difficult. One prominent example is the synthesis of oligos containing a high percentage of 'G' residues, in particular, stretches of 'G'. Besides synthetic challenges, these oligo are also difficult to purify, becuase such oligos with 4 or more 'G's in a row tend to aggregate and form a 'guanine tetraplex' (Poon & MacGregor, 1998, Biopolymers 45:427–434). Similarly, oligos with self-complementary sequences tend to form aggregates which can complicate HPSF and HPLC purifications.

The term synthesis scale indicates the amount of the first nucleotide of the sequence used to initiate the synthesis. This quantity defines the quantity of reagents used in the subsequent steps.
The synthesis yield is the amount of oligo isolated after the synthesis is completed; this yield is dependent on the coupling efficiency acheived in each chain extending step of the synthesis. 

In the custom oligo order editor, enter the name and sequence of the oligo. Then you can select the modifications you want at the 5′ and 3′ using the drop down menus. For modifications in the internal positions, we recommend that you 'insert' the modification where the cursor is placed after the selecting the required modification in the dropdown menu. Please note that the designators cannot have typographical errors; we therefore recommend that you inset the internal mods. Once you place the order, these oligos will be delivered to you in tubes. For a larger volume of oligos, please use the custom oligos in plates order editor.

The table here provides the estimated turnaround time for the shipment of a standard unmodified oligo order. Please note that oligos with modifications, post-synthesis purifications or other custom services will have a different turnaround time.

Summary
Annealing protocols are fairly standard and can be found on the internet through search engines or on different company websites. The protocols are generally the same but may differ in reagents and incubation times / temperatures. Eurofins has a sample annealing protocol attached to this FAQ. The protocol may be modified or optimized to your specifications.

NOTE: Annealed dsDNA oligos should be stored at –20 °C or kept on ice when on the benchtop.

For your convenience Eurofins has an added feature when ordering through the website to have the reverse complement sequence.

Annealing Buffer: 10 mM Tris, pH 7.5–8.0, containing 50 mM NaCl and 1 mM EDTA

1x TE Buffer: 10 mM Tris, pH 7.5–8.0 containing 1mM EDTA

Step 1. Resuspending the Oligonucleotides: Resuspend both complementary oligonucleotides at the same molar concentration, using Annealing Buffer (see note below). For convenience, keep Annealing Buffer volume below 500 μL for each oligo. Annealing should perform well over a wide range of oligo concentrations. For larger scale oligo syntheses, it may be necessary to use larger volumes that can be aliquoted after resuspension.

Step 2. Annealing the Oligonucleotides: Mix equal volumes of both complementary oligos (at equimolar concentration) in a 1.5-mL microfuge tube. Place tube in a standard heatblock at 90–95 °C. Remove the heatblock from the apparatus and allow to cool to room temperature (or at least below 30 °C) on the workbench. Slow cooling to room temperature should take 45–60 minutes. Store on ice or at 4 °C until ready to use. An alternative procedure for annealing involves the use of a thermal cycler. Dispense 100 μL aliquots of the mixed oligos into PCR tubes (500-μL size). Do not overlay the samples with oil. Place the tubes in a thermal cycler and set up a program to perform the following profile: (i) heat to 95 °C and remain at 95 °C for 2 minutes, (ii) ramp cool to 25 °C over a period of 45 minutes, (iii) proceed to a storage temperature of 4 °C. Briefly spin the tubes in a microfuge to draw all moisture from the lid. Pool samples into a larger tube, store on ice or at 4 °C until ready to use.

Step 3. Long Term Storage: It may be necessary to aliquot and lyophilize the annealed sample. After drying, the sample may be stored at –20 °C in a desiccated container. Resuspend the annealed oligos at the desired concentration with sterile distilled water. The annealed pair of oligonucleotides is ready for use.

NOTE: Oligos may also be resuspended in either 1x Ligase Buffer or 1x Kinase Buffer instead of the above Annealing Buffer (prior to annealing).

Unmodified oligos can be used for at least 12 months after purchase when stored wet at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same sequence, aliquot the sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility contamination with nucleases or bacteria.

Before opening, spin the tube at 1000 rpm for 5 min to ensure that the oligonucleotides are at the bottom of the tube. Oligonucleotides should be resuspended in a sterile buffered solution (e.g., TE at pH 7.0). Vortex oligonucleotides thoroughly after resuspension. The oligonucleotides may not readily dissolve in sterile, distilled water. The addition of NaOH to the water until the pH rises to 7.0 may help. If the oligonucleotides are resuspended at pH <7.0 (deionized water may have a pH as low as 5.0), the oligonucleotide could begin to degrade and may lose functionality within a couple of weeks.

For optimal long-term storage, oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry them and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

All of the oligos synthesized at Eurofins are single-stranded DNA oligos. We do produce GeneStrands, which are linear dsDNA gene fragments, and Genes (>100 bp) after ligating and assembling these single-stranded DNA oligos. However, for oligos of length <100 nts, we do not offer dsDNA. To get dsDNA you can order the reverse complement oligo and anneal the oligos using our annealing protocol or the annealing protocol of your choice.

To confirm that the oligos annealed properly, we recommend running the annealed double-strand (ds) oligos in one lane and the single strand (ss) un-annealed oligos in two seperate lanes of a non-denaturing polyacrylamide gel 4–15%. Thaw the double-stranded (ds) DNA on ice and and run a minimum of 5 μL of ds oligo solution (0.5 μM) in lane 1, 5 uL of ss oligo solution (sense; 0.5 μM) in lane 2, and 5 μL of ss oligo (anti-sense; 0.5 μM) in lane 3. The bands in lane 2 and 3 represent the hairpin structures formed by unannealed ss oligo for the sense and anti-sense sequences ordered, and the band should run twice as fast as the ds oligo in lane one of gel. If available a 10 bp sizing ladder should be run in another lane on the gel.

The most common calculations are for Molecular Weight, Extinction Coefficient, Picomoles, Micrograms, Concentration, Melting Temperature, and Annealing Temperature. Explanations of these calculations can be found on our Calculations Page.

Mutations or alternations in sequence are rare in synthetic oligos but they can happen. Oligos may become depurinated in some positions during the synthesis process. A longer oligonucleotide is more likely to have more depurinated sites than a shorter oligo. These depurinations may become visible in applications like cloning where single molecules are selected and propagated. Typically the depurinated sites are replaced by any base. Usually only some oligonucleotide molecules are affected. If you have sequenced only one clone and found a 'mutation' in it, sequencing another independent clone will in most cases result in the correct sequence. When choosing clones, it is most important to select independent ones. To get independent clones, the pre-incubation time before plating should be based on the manufacturer instructions of your cloning system. Optimal density of the clones on the plate ensures that well separated clones can be selected.
As the risk of depurinations increases with the length of the oligonucleotide, we recommend the use of short sequences for cloning. If long oligos (>40 nt) have been used for cloning, consider increasing the number of clones that need to be sequenced. More recently, increase coupling efficiencies and accurate reagent delivery mechanims have enabled us to develop oligos with very few sequence errors. The use of these oligos—TRUEmers—can further reduce the number of mutations observed during cloning.
Please note that synthetic oligos do not contain a phosphate at the 5′-end which is necessary for enzymatic ligation reactions. However, the phosphate group can be added as a modification to the 5′-end of the oligo. If you find a 'mutation' in multiple clones please contact GenomicsSupport@eurofins.com.

For each potential position for the ester, Eurofins Genomics recommends and uses select amino modifiers as linkers. When you order an ester modification to your oligo sequence, one of these amino linkers are automatically added to your oligo, depending upon position of attachment.

5′ ester modification: Amino Modifier C6
Internal ester modification: Uni-Link amino modifier
3′ ester modification: Amino Modifier C7

Alternatively you can use AminoC6-dT.

Our customers' experiences and our internal research findings demonstrate that these amino linkers are highly reliable for conjugation and work well for the majority of experimental applications. On occasion, however, your experiment may require the fractional increase in specificity that can be achieved if you replace a T base within your sequence with the Amino C6 dT or Amino C2 dT attachments. If you would like to use either of these, please contact us through GenomicsSupport@eurofins.com.

Certain oligo modifications can only be attached to the oligo via a post-synthesis ester conjugation because a form of the modification that can be used directly on the synthesizer is not available. The reaction requires 2 substrates: (1) an oligo which contains an amino linker, and (2) the desired modification. All modifications attached through esters require HPLC purification to eliminate the unreacted substrates.

Yes. Fluorescent dye-labeled oligos are more fragile than unmodified oligos. Their ability to fluoresce will decrease over time. Before opening, spin the tube at 1000 rpm for 5 minutes to ensure the oligos are at the bottom of the tube. To ensure high quality, store the oligo dry at –20 °C in small aliquots. Note also that fluorescent dye-labeled oligos should be stored in the dark as light can slowly degrade the fluorescent moieties.
For optimal long-term storage, it is recommended that the labeled oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry all aliquots, and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

Fluorescent dye-labeled oligos can be used up to 6 months from purchase when stored dried at –20 °C in the dark.

Oligonucleotides labeled with fluorescent dyes, such as 6-FAM, HEX, TET, ROX, and TAMRA should be resuspended in a slightly basic solution (e.g., TE at pH 8.0). Cy3, Cy3.5, Cy5, and Cy5.5 labeled oligonucleotides should be resuspended at pH 7.0. Cy3, Cy3.5, Cy5, and Cy5.5 begin to degrade at pH >7.0. If brought to a pH below 7, it has been shown that the oligo can begin to degrade and may be unusable within a few weeks.

Unmodified oligos are stable molecules and can be used for at least 12 months after purchase when stored at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same sequence, aliquot the sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility contamination with nucleases or bacteria.

Per OSHA 29CFR1910.1200, Commonwealth of Australia [NOHSC:1005, 1008(1999)] and the latest amendments to the European Union Directives 67/548/EC and 1999/45/EC, Synthetic DNA does not require a Material Safety Data Sheet (MSDS). Synthetic DNA does not contain more than 1% of a component classified as hazardous and does not contain more than 0,1% of a component classified as carcinogenic. Therefore Eurofins Genomics does not provide a MSDS for Synthetic DNA. However, when working with these or any chemical reagents, we always recommend the use of gloves, lab coats, and eye protection. Eurofins Genomics assumes no liability for damage resulting from handling or contact with Synthetic DNA.

The melting temperature (T_m) of an oligonucleotide is dependent upon a number of factors including the length and G+C content of the sequence as well as the type and concentrations of cations present, particularly the sodium ion, Na⁺. A variety of formulas have been used for predicting melting temperatures. The following formula is recommended for oligonucleotides ranging in length from 20 to 100 residues and sodium concentrations ([Na⁺]) ranging from 0.01 M to 1.0 M. The T_m reported on the data sheets shipped with the oligos assumes a [Na⁺] of 0.1 M, the log of 0.1 is -1:

T_m = 81.5 + (16.6 * log[Na+]) + (41 * (G+C) / oligo length) – (500 / length)

It is important to remember that different websites, programs, and software may use a different equation for calculating the melt temperature of an oligo. Any calculated T_m is theoretical, and the truest method for determining the T_m of an oligo is through experimental analysis.

For a detailed breakdown on the length and synthesis scale of the oligo nucleotides, please visit the custom DNA oligos page here. For information on long oligos, go to the EXTREmers webpage. For information on double-stranded DNA fragments, go to the GeneStrands page.

Yes. The phosphodiester backbone, also referred to as the phosphor backbone, is the normal backbone for our synthesized DNA oligos. Phoshphorothiated oligos, sometimes called S-oligos, have a sulfur replacing one of the oxygens in the phosphate backbone between the bases. Oligos with phosphorothioate modification can be used to induce a strong immune response in living organisms, as they are very stable against nuclease degradation.
Here are some examples of how you can order oligos with phosphorothioate bonds):
T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (Phosphorothioate between every two contigous bases)
T*C*C*A*T*GACGTTCCTGAC*G*T*T (Phosphorothioate between only some bases and phosphodieste between others)
TCCATGACGTTCCTGACGTT (Phoshpodiester between every two contigous bases)

Eurofins Genomics strongly recommends the use of software to design DNA sequencing primers. The Oligo Toolkit and Plotter displays secondary structure as well as other useful information such as melting temperature, GC content, etc. For cycle sequencing, primer length should be between 18 and 28 bases with a GC content of at least 50%. The melting temperature of the primer should be between 50 °C and 70 °C. It is important to avoid selecting primers that form dimers or hairpins as molecules in this conformation will not participate in primer template hybridization. Additionally, if a 3′ overhang is formed by a dimer or hairpin, the polymerase will extend and form unwanted products.

Dual-labeled probes (fluorescence quencher or FQ probes) have a fluorescent reporter and a quencher at their 5′ and 3′ ends, respectively. These probes can be used in quantitative PCR systems that take advantage of the 5′→3′ exonuclease activity of Taq DNA polymerase. A probe specific for the sequence of interest is used together with specific PCR primers. This probe is designed to anneal between the PCR primers. During the extension phase of PCR, the 5′→3′ exonuclease activity of Taq DNA polymerase cleaves the fluorescent reporter from the probe. The amount of free reporter accumulates as the number of PCR cycles increases. The fluorescent signal from the free reporter is measured in real-time and allows quantification of the amount of target sequence. There are several design considerations to keep in mind when designing dual-labeled probes. Placement of the probe is important; the probe should be designed first, followed by the design of the PCR primers. The probe should anneal near the center of the amplicon, and the amplicon should be 50 to 150 bases long. The probe's melting temperature should be 68 °C to 70 °C. The probe should be at least 20 bases long to prevent nonspecific annealing. Finally, avoid designing the probe with a dG at the 5' terminus as dG is a weak quencher. Any dG in the primer should be at least 2 residues away from the 5' terminus.

Probe:
G-C Content: 30–80%
polyNNN: Avoid stretches of same nucleotide, especially 4 or more Gs
End Composition: No Gs at 5' end
T_m: 68–70 °C
Strand: Select strand with more Cs than Gs. If the compliment is used, make sure there are no Cs at the 3' end.
Length: Less than 30 bp
Design: Quencher on 3' end dye on 5' end

Primer:
G-C Content: 30-80%
polyNNN: Avoid stretches of same nucleotide, especially 4 or more Gs
End Composition: 5 bases at 3' end should have no more than 2 G/Cs. Try to use As at 3' end so primer dimers will be degraded more efficiently.
T_m: 58–60 °C
Product: 50 to 150 bases
Design: Choose after probe. Design as close to probe as possible without overlap. Have one primer cross one exon junction to amplify mRNA.

Molecular Beacons, like dual-labeled probes, have a fluorescent reporter and a quencher at their 5' and 3' ends, respectively. The sequence of these probes is designed so that they form a hairpin structure in which the fluorescent dye and the quencher are in close proximity. A Molecular Beacon specific for the sequence of interest is used in PCR. The probe is designed to anneal between the PCR primers. When the probe hybridizes to its target sequence in the PCR annealing step, the loop opens and the fluorescent reporter and quencher are separated, resulting in a fluorescent signal. The amount of signal is proportional to the amount of target sequence, and is measured in real-time to allow quantification of the amount of target sequence. In order to successfully monitor PCR, Molecular Beacons should be designed so that they are able to hybridize to their targets at the annealing temperature of the PCR, whereas the free Molecular Beacons should remain closed and be non-fluorescent at these temperatures. This can be ensured by choosing the length of the probe sequence and the length of the arm sequences appropriately. The length of the probe sequence should be such that it will dissociate from its target at temperatures 7–10 °C higher than the annealing temperature of the PCR. The melting temperature of the probe target hybrid can be predicted using the "percent-GC" rule, which is available in most probe design software packages. The prediction should be made for the probe sequence alone before adding the stem sequences. In practice, the length of the probe sequence is usually in the range from 15–30 nucleotides.

When not bound to its target sequence, the Molecular Beacon forms a hairpin structure. The proximity of the fluorescent reporter with the quencher prevents the reporter from fluorescing. During the PCR annealing step, the Molecular Beacon probe hybridizes to its target sequence. This separates the fluorescent dye and reporter, resulting in a fluorescent signal. The amount of signal is proportional to the amount of target sequence, and is measured in real-time to allow quantification of the amount of target sequence.

- T_m of probe + target hybrid (loop only) has to be 7–10 °C above T_anneal
- T_m of stem is 7–10 °C higher than the detection temperature (=annealing temperature of the PCR)
- The loop of the probe should be 15–30 nucleotides long
- The stem of the probe should be 5–7 bases on each side
- The amplicon should be less than 150 bp

If your PCR reaction used to work and then stopped, the primers or template may have become degraded. The primers can last up to 1 year if stored lyophilized and aliquoted at –20 °C. Freezing and thawing causes the primers to degrade. Primers or template can also degrade due to contamination. Millipore filtration systems, which require the filter to be changed periodically, can supply water of questionable quality at the end of a cycle. If you are using a filter system, check to see if your filter was changed soon after resuspending your oligos. You may want to consider changing the filters more often if this is the case.

Complementary primers can cause PCR artifacts, especially in control lanes (without template). The primers anneal to each other and extend, sometimes creating large products. The extra bands that appear in the control lane often disappear in the presence of competing template. Depending on the degree of complementarity, raising the annealing temperature may help if there are extra bands in other lanes.

The yield has many contributing factors. The primary reason why you might see different yields for the same oligo is that the columns are not loaded with exactly the same quantity of CPG. For example, a 50 nmol column will have a minimum of 50 nmols of 3' base available to start synthesis, but frequently has more than this amount. Keep in mind this is the starting scale and not the final yield.

The most common reason for this is that the oligos are not fully dissolved. If you resuspended in water, you may need to add NaOH to raise the pH to between 7 and 8. Oligos resuspended in water tend to have a pH of around 5, and this is often too low for them to completely dissolve. We recommend that most oligos be resuspended in TE at pH 7. We find that 10 mM Tris-HCl, 1 mM EDTA works well, but if your experiment cannot tolerate EDTA, you may use just Tris-HCl.

Oligonucleotides are most commonly quantified by measuring their UV absorbance at 260 nm. A single-stranded oligonucleotide dissolved in a neutral aqueous solution at a concentration of 33 µg/ml will have an absorbance at 260 nm of approximately 1.0 A.U. The optical density (OD) unit is defined as the absorbance (at 260 nm in a 1 cm cuvette) multiplied by the sample volume (in milliliters), so that 1 OD unit is roughly 33 µg of ssDNA.

Unlike most oligo manufacturers, Eurofins Genomics does not use liquid ammonia for deprotection. As our oligos are never exposed to ammonia they are not contaminated with ammonia salts. To increase the purity of our basic oligo further, we also desalt all oligos to remove any chemicals left from the synthesis and deprotection processes. This is why our oligos are called salt free.

When HPLC purification is ordered, several methods of HPLC purification could be used. For unmodified oligos, ion exchange purification is often performed as this method typically provides the best separation of full length oligos from the lesser products. On certain modified oligos we use reversed-phase HPLC as the modification increases the hydrophobicity of the modified versus unmodified oligos providing the best separation for these products. Two-step HPLC purification, which includes reversed-phase HPLC followed by ion exchange HPLC, is recommended for oligos longer than 70 bases.

The following chart indicates standard purification levels for different applications. For any oligo longer than 70 bases, 2-step purification methods are highly recommended. If you are unsure of which purification method to order, please consult the protocol for your intended application. Recommended purification levels:

✔ = Unmodified DNA oligo, ✔ = Modified DNA Oligos

HPSF purification produces salt-free oligos in high yields. Typical purity levels are about 70%, but no guarantee of purity is made. HPSF purity oligos can be used in any application where salt-free oligos are used, but a little extra purity is desired.
HPLC purification uses reversed-phase or ion exchange HPLC columns to produce oligos with 85%+ purity levels. It is available for a wider range of oligo types.

No. The scale of synthesis is the amount of the 3'-terminus base that the multi-step synthesis started with, it is NOT the expected final yield. The yield depends on the size of the oligonucleotide, the coupling efficiency, and the base composition. The datasheet included in each oligo shipment contains all the necessary data pertaining to that order. For PCR the 50 nmol scale yields approximately 1,000 to 5,000 reactions and the 0.2 µmol scale yields 4,000 to 20,000 reactions (100 µl @ 0.1 to 0.5 µM).

Currently >90% of results are delivered the same day the samples are received. The exact time varies but typically it ranges between 5PM - 11PM EST.

Any number of samples is welcome. There are no minimums or limitations.

Dropboxes are available in many locations. Also, Eurofins is the only sequencing company that offers free digital shipping labels on >95% of orders. Take a look at our sample submission page for details.

The equipment vendor reports accuracy of 99.3%. The research community has reported accuracy between 93-98%.

There are pros and cons of every sequencing method. Sanger sequencing and Oxford Nanopore sequencing (ONT) are both methods for determining the sequence of nucleotides in a piece of DNA. Typically Sanger is consider the most accurate method for short-read sequencing and NGS is better for long-read sequencing.

Overall, the choice between Sanger sequencing and ONT will depend on the specific needs of the application. Both methods have their strengths and limitations, and the appropriate method will depend on factors such as the length and quality of the DNA sample, the desired level of accuracy, and the cost and availability of the necessary equipment.

Absolutely. Using our free barcode labels is not required, but always an option.

Absolutely, yes.

You can send it and we can sequence it, but we cannot predict or promise the analysis outcome. The customer would take on the risk of these orders.

The process is almost identical between Whole Plasmid Sequencing and Amplicon Sequencing.

1. Ordering is the same, using the same order pages.
2. Results are the same, with Amplicon sequencing offering all the same file types.
3. The sample submission guidelines is the same for both.
4. The turnaround time is generally the same.

It is easy. Go to our online ordering page.

Place order

We will be rolling out the new order page across portal sites, marketplaces, and punchouts very soon. At the moment, please submit orders on the main www.eurofinsgenomics.com website.

It really depends on the sample quality. We cannot guarantee the level of coverage at this time. A good sample submitted properly will typically yields hundreds or even thousands of sequencing reads. Consensus coverage depends on how many reads are full-length plasmids and how many, if any, degraded.

1. .fasta file (for consensus data): we will provide a clean, complete consensus sequence for each plasmid.
   
2. .gbk GenBank file (for consensus data): a pLannotate map in the GenBank file format.
3. .fastq file - raw data on reads.
4. Histogram file: the hisogram file provides a visual representation of the plasmid and raw read data for deeper insight into your samples (image).
5. .html pLannotate map (for consensus data): a plasmid map for each sample.
   
6. .csv confidence file with quality statistics.

The probability of failure is low when using WPS, although it can still happen. If you wish to resequence a failed sample, contact Genomics Support. Unfortunately, we must charge for failed samples since it requires more time and energy than a normal run on the machine. If the sample fails a second time, all data points to a problem with the sample and we cannot resequence. In that scenario, we advise the customer to either send a new sample or troubleshoot the sample from their end.

You can send it and we can sequence it, but we cannot predict or promise the analysis outcome. The customer would take on the risk of these orders.

The process is almost identical between Whole Plasmid Sequencing and Amplicon Sequencing.

1. Ordering is the same, using the same order pages.
2. Results are the same, with Amplicon sequencing offering all the same file types.
3. The sample submission guidelines is the same for both.
4. The turnaround time is generally the same.

It really depends on the sample quality. We cannot guarantee the level of coverage at this time. A good sample submitted properly will typically yields hundreds or even thousands of sequencing reads. Consensus coverage depends on how many reads are full-length plasmids and how many, if any, degraded. Generally speaking, the coverage for linear/amplicon samples is similar to whole plasmid sequencing.

Prevalent error patterns in Oxford Nanopore sequencing often manifest as deletions within homopolymer stretches and inaccuracies occurring specifically at the central position of the Dcm methylation site, CCTGG or CCAGG. Anticipated advancements in sequencing chemistry and basecalling software updates are poised to ameliorate these limitations in the foreseeable future.

The assembler occasionally encounters challenges in reconstructing the terminal ends of linear DNA, potentially leading to the omission of approximately ~25 nucleotides from the 3' and/or 5' ends of your insert, contingent upon your sample's sequence. Should you observe this occurrence, you have the option to download the raw reads from your Dashboard and employ your preferred methodology to reconstruct the ends.

The probability of failure is low when using WPS, although it can still happen. If you wish to resequence a failed sample, contact Genomics Support. Unfortunately, we must charge for failed samples since it requires more time and energy than a normal run on the machine. If the sample fails a second time, all data points to a problem with the sample and we cannot resequence. In that scenario, we advise the customer to either send a new sample or troubleshoot the sample from their end.

Typically 2 days. If extraction is required, the turnaround time is 1 week. In rare instances, it may take longer depending on the complexity of the project and the volume of samples being processed.

The process is almost identical. Go to the normal order page and you will see an option to select bacterial genome in second step of the order process.

Oxford Nanopore touts accuracy of 99% raw read accuracy. The scientific community has reported results ranging from 93-98%. Final assembly is contingent upon both coverage and data quality. A higher coverage, denoting an increased number of reads used to construct a consensus, typically augments the accuracy of the obtained results.

The minimum targets for successful sequencing can be found on the bacterial genome webpage. In short, the target is 30x coverage which equates to 210 Mb for medium size samples and 360 Mb for the larger size.

All the same data files are provided as found with whole plasmid and amplicon sequencing, plus an additional report.

1. .fasta file (for consensus data): we will provide a clean, complete consensus sequence for each plasmid.
   
2. .gbk GenBank file (for consensus data): a pLannotate map in the GenBank file format.
3. .fastq file - raw data on reads.
4. Histogram file: the hisogram file provides a visual representation of the plasmid and raw read data for deeper insight into your samples (image).
5. .html pLannotate map (for consensus data): a plasmid map for each sample.
   
6. .csv confidence file with quality statistics.
7. Comprehensive report: an example can be downloaded and viewed from the sidebar.

If none of the targets set for successful sequencing are met, then our technicians will evaluate the results to determine the feasibility of achieving a more successful outcome a second time. If there is potential for success, typically a repeat is run at no additional cost. Customers may submit a repeat request for evaluation as well. However, should the desired outcomes not be attained during the second attempt, or if our technicians determine that the potential for success in a second run is low, then further repeats will not be initiated. Should you opt to sequence the sample anew, it is imperative to prepare fresh samples that adhere to all quality control (QC) requirements before submitting a new sequencing request.

This service is designed for the analysis of clonal populations, specifically a single species of bacteria. While it is permissible to submit mixtures of different bacterial species for sequencing, predicting the assembly outcome is challenging, and therefore, it is undertaken at your own risk. The total raw data acquired for your sample will be proportionally allocated among the different species present. Consequently, this division diminishes the individual genome coverage of each species, potentially impeding the assembly of specific species within the sample. Re-sequencing mixtures does not alter the relative proportions of the species. However, if higher total coverage is needed, multiple aliquots can be submitted. The ultimate determination of which species yield an assembly depends on the overall sample quality, coverage, and the relative abundance or degradation of each species.

Should your genomic DNA (gDNA) extraction encompass native plasmid DNA, it is likely that corresponding sequencing reads for these plasmids will be obtained. The standard sequencing procedure typically excludes input DNA fragments smaller than 3kb. However, we do not selectively filter out diminutive plasmid-sized reads during the assembly process. Consequently, it is probable that these smaller reads will contribute to the creation of distinct plasmid assemblies alongside the overarching gDNA assembly. The ultimate outcome, determining which DNA types within your sample contribute to the assembly, hinges on factors such as overall sample quality, coverage, and the relative abundance or degradation of each DNA type.

Certainly, any species is technically amenable to sequencing and assembly using this method. However, it is essential to acknowledge that submitting samples for applications beyond bacteria entails inherent risks. This is due to the fact that we have not fine-tuned the optimal data requirements for various specimen types, and our assembly/annotation pipeline is primarily tailored for bacteria.

For non-bacterial applications, there may be a necessity to submit multiple aliquots of each sample to ensure adequate genome coverage for larger and more intricate eukaryotic genomes. It is important to highlight that data from all aliquots must be amalgamated before initiating your assembly pipeline.

In the event of planning to submit a substantial number of samples for such off-label applications, we strongly recommend reaching out to us prior to submission. This proactive communication will facilitate discussions on viable options and ensure a more informed approach to meet your specific requirements.

Yes. You can select specific 3′ and 5′ restriction enzymes from the drop down menu of the Gene Synthesis Ordering Wizard. The wizard will automatically add the appropriate DNA sequences to your gene. The complete gene sequence with restriction sites will be displayed for your review prior to moving your genes into the Shopping Cart.

We can synthesize sequences or complete genes from very short fragments up to several thousand base pairs in length. As each synthetic gene project is unique, we'll be able to provide more information when you contact us for a quote.

Eurofins utilizes GENEius™ sequence optimization software, when requested, to optimize all aspects of your synthetic gene. You enter the amino acid or DNA sequence and GENEius software optimizes your construct in 4 dimensions:

• Codon optimization
• Secondary structure avoidance
• GC content optimization
• Bad motif avoidance

We believe that our optimization will result in better protein expression. But, to be absolutely certain we compared our optimized sequences with those optimized with other software packages. Download our White Paper to see the results.

Due to limitations in oligo synthesis chemistry and other practical considerations, oligos are produced as mixture of single-stranded DNA strands and are limited in length to ~200 nucleotides. Synthetic genes, however, can extend to several thousand, double-stranded base pairs. Usually created as a sequence verified clone, these constructs may be the best tool for your research needs.

A gene that has been cloned into a vector has been fully sequenced and confirmed to have 100% sequence identity to the expected sequence; a PCR product represents a mixture of correct and incorrect sequences due to errors incorporated during polymerase chain reaction. As a consequence of this property of polymerase, subclones created from the original confirmed clone may show variation from the expected sequence. Whenever you use cloning methods that incorporate PCR products for your cloning experiments, we recommend sequencing at least 6–12 colonies to identify one with the expected sequence.

When Eurofins Genomics delivers your cloned gene and any additional plasmid preps ordered by you, you will receive materials with the 100% correct sequence and a dried vector with the gene insert of a 100% correct clone.

Yes, Eurofins Genomics will create your gene in as many vectors you may choose. One popular example is for customers to order a standard clone, a second construct in a shuttle vector and also a third clone in an expression vector.

A vector is a plasmid or small strand of DNA into which a non-native DNA fragment (usually a synthetic gene) can be inserted via restriction enzyme treatment followed by ligation. Cloning vectors are utilized primarily for the replication of the gene insert. Expression vectors on the other hand are genetically engineered to enhance and promote the transcription of the gene insert to facilitate the expression of large amounts of its recombinant protein within the host cell. Besides the presence of expression signals most expression vectors can be distinguished from cloning vectors by the presence of protein tags. Most of these tags are used to help in the purification of the recombinant protein from the proteins of the host cell.

Protein tags are peptide sequences appended to recombinant proteins to modify them for various post-translational applications. There are numerous types of protein tags for different applications. Some protein tags can be used in tandem to confer dual functionality. The following are a few examples of the uses of protein tags.

• To aid protein folding in chaperone-deficient hosts (solubility tags)
• To facillitate protein purification by changing chemical characteristics of the recombinant protein (affinity tags)
• To label recombinant proteins (fluorescent tags)

No. We do not provide protein-tagged vectors. If you would like a protein tag incorporated into your vector, you can either send Eurofins Genomics your protein-tagged vector and we will insert your synthetic gene into it or you can add the protein tag sequence to your gene sequence.

Yes. You can insert protein tag sequences into the 5′ and/or 3′ untranslated regions (UTRs) on the wizard. The UTRs are not optimized by GENEius software.

We verify each synthetic gene using DNA sequencing of both strands and ensure 100% sequence accuracy for every synthetic gene. Our gene synthesis lab maintains the highest quality standards throughout the complete synthesis process. The quality management system for our Louisville, Kentucky facility has been certified to ISO 9001:2008 and ISO 13485:2003 standards.

The standard delivery times are:

For Standard Genes (160–1,000 bp):	6 working days
For every additional ~950 bp:	+5 working days
For Complex Genes:	Please inquire
Additional subcloning into customer vector:	5–10 working days

Click on the Order Now button to bring up the Gene Sythesis Ordering Wizard. This wizard will guide you through the process of entering your gene information, optimizing your gene sequencing, and selecting the proper vector and preparation scale. Upon completion of the wizard, your gene is placed in your Shopping Cart. After you have entered and optimized all of your genes, a simple checkout process will place the order with our lab.

Among the many uses for synthetic genes are adapting codon usage for optimizing gene expression, for protein over-expression and/or protein engineering; as standards for Real Time PCR and standard PCR, mutagenesis studies, to construct hybrid genes, and the production of DNA vaccines.

The formation of potential hairpin structures of 4 or more bases should be avoided within your synthetic gene sequence. Also, sequences that are commonly associated with poor oligo quality such as long stretches of single or di-nucleotide repeats, or high GC content should be avoided. To achieve high levels of gene expression (protein production), we also recommend that you avoid sequences that introduce rarely used codons into a gene.

Our proprietary GENEius sequence optimzation software will optimize your gene, even if your original sequence contains some of the problem sequences listed above. Even many native gene sequences benefit from optimization in addition to codon optimization for a non-native host.

There are three different approaches for the assembly of synthetic genes. In the approach developed by Khorana (Gupta et al., 1968), a series of sequentially overlapping oligonucleotides are synthesized. As the complementary sequences of the oligos anneal, double-stranded DNA fragments containing nicks on both strands are formed. The nicks are repaired with DNA ligase, an enzyme that catalyzes the formation of a phosphodiester bond between the 5′-phosphate of one double-stranded oligo fragment and the 3′-hydroxyl terminus on an adjacent double-stranded oligo fragment.

Another broadly used approach is the one developed by Narang (Scarpulla et al., 1982) making use of the template-directed and primer-dependent 5′ to 3′-synthesis capability of the large subunit of the enzyme DNA-Polymerase I (Klenow fragment). After end-to-end annealing of the oligos, Klenow uses deoxynucleosidetriphosphates to fill the gaps. Treatment with DNA ligase repairs any nicks in the resulting, double-stranded DNA.

An alternative strategy has been developed, using very long oligonucleotide chains. In this approach (Rossi et al., 1982), two long oligos are synthesized and upon annealing, their 3′-ends will overlap. The construct is completed to a full length double-strand using a DNA polymerase to fill in missing bases. After treatment with the polymerase, overhanging ends are generated on the double-stranded fragment by digestion with the appropriate restriction enzyme.

Typically all of these methods are followed by the molecular cloning of the gene into an appropriate vector, so technical limitations of subsequent cloning steps must be considered while developing the assembly strategy. For example, assemblies for larger genes may be divided into sub-assemblies which are sequenced to confirm 100% identity and then brought together to complete the full construct which receives a second round of sequencing to verify the full assembly.

When you need the mutations to be distributed across the whole gene, we recommend de novo synthesis. De novo synthesis allows you an opportunity to also optimize features of the gene such as codon usage, GC content, restriction sites, etc. Site-directed mutagenesis is best used when the modifications are few, or are clustered in a small area of the gene.